GenePrediction:GLEAN_6085 Details

Name: GLEAN_6085
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2431459..2430122 (- strand)
Length: 1338
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2431459..2431388 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_144:2431301..2430636 (- strand)
Length: 666
Type: CDS
Source: GLEAN
Position: GCSC_144:2430583..2430122 (- strand)
Length: 462
>GLEAN_6085 class=GenePrediction position=GCSC_144:2431459..2430122 (- strand)
ATGTCTTCTGTCAACGGTACTTCTAGCCTGCCGGCATGGCAGACACACAAGTCTGGCACGTTTCTTTTCACTGTAAGACT
CATTCCATGGATCAATTCTTCAAGCCCAGAAATTGTAGTACGTGTTGGACAATTTGTTCTGACTTTAAATGCCGTTAGTC
CGAATCAGTTGGTGAAGGTCACCCTGATAAGATTGCCGACCAGGTCTCGGATGCCGTTCTTGATGCTTGTCTGAAAGACG
ACCCTCTGTCTAAGGTAGCCTGCGAGACAGCCACCAAGACGGGTATGGTCATGGTCTTCGGTGAGATCACCACCAAGACT
CGACTTGACTACCAAAAGGTCGTCCGTGACGCTATCAAGGACATCGGCTATGATGATTCTGCAAAGGGATTTGACTACAA
GACTCTCAACCTTCTTGTTGCTATTGAGGAACAATCTCCCGATATTGCTCAGGGTCTCCACTATGAGAAGGCTCTGGAGG
AGCTCGGTGCTGGTGACCAGGGTATCATGTTCGGCTATGCTACCGATGAGACCCCTGAGCTCTTCCCCCTCACTCTGCTG
TTAGCTCACCGCCTCAATGCTGCAATGTCCGCTGCTCGCCGTGACGGCACTCTACCGTGGTTGCGCCCCGACACAAAAAC
CCAGGTGACCGTTGAATACAAGCATGACAATGGTGCCGTCGTCCCCCAAAGAGTCCACACGGTTGTCGTATCAGCCCAGC
ATAGTGAGCATATCACTACGGAGAAGCTGCGCTCTGAGATCAAAGAAAAGATCATCAAGAAGGTCATTCCAGCTCAGTAC
CTGGACGACGAGACGATCTACCATGTATGTTTGGCGATTTAAACTAGCATCTCCGATTTACTAACGCTCACCCTAGATCC
AACCCTCCGGCCTGTTCATCATTGGAGGCCCCCAAGGTGATGCTGGCCTGACTGGCCGAAAGATCATCGTAGATACTTAC
GGTGGTTGGGGTGCTCATGGTGGTGGCGCTTTTTCTGGAAAGGATTTCTCTAAGGTTGACCGGTCAGCTGCCTACCTTGG
TCGCTGGATTGCAAAATCACTGGTTGCTGCAGGCTTGGCCCGTCGTGCGCTAGTTCAGCTTTCGTACGCCATCGGTGTAG
CTGAGCCGCTTTCGTTGTTTGTCGAGACATATGGCACGTCCGAGAAGACGTCAGACGAGCTTGTCGAGATCATTCGTAAC
AACTTCGACATGCGCCCCGGTGTTATTGTCAAGGAACTGGACCTGGCAAAGCCCATTTACTTCCAGACGGCCAAGAATGG
TCACTTCGGCACTAACCAGAGCTTCAGCTGGGAGAAGCCGAAGACTCTCAAGTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62