GenePrediction:GLEAN_6086 Details

Name: GLEAN_6086
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2405318..2404715 (- strand)
Length: 604
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2405318..2405294 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_144:2405133..2404715 (- strand)
Length: 419
>GLEAN_6086 class=GenePrediction position=GCSC_144:2405318..2404715 (- strand)
ATGGACGGCGACAATTATTCTAGAGGTCAGTTTTAAAATGGCGCAAATTTGCGAACAGCACGATATTAACTCGGACATTA
CAGAGGGAGGACGGCAAGGTGGTTCCCGCAACCATCAGGTACGCGACAAACCAAACAATCTTTTGCTTTGACCCTTTACT
CACGCAATTTTTCACAGCTGTCCAGGACTGATCGCAACGATCGTAGCGATCGTGGCGATCGTGAGCGAGGCGAGCGCAGC
CGAAGACGATCACGCTCACCCGCAGACTATAGGGGAGGGAGAGGTTTACGTCGTGATGCAGAAGCTGACAGCTATTCGTC
CTCCCGCAGCCACAGAGATCGGGAACGAGAGGACCGCTACTCTGGTAGAGACAGACGTGACCGAGAACCGTGGGATCGCG
ACAGAGAACGGGAACGGGACCGTGGTGTTAGACGAGAGGTGCGACGAGATGAGGATCGGCAATTACAGCGCGACGCGCAC
GACACTCGGCCTCGTGGTGGCCGTAGAGAACGAGAAAGAGATTTTGACCGAGATCGCGATCGGAGGCGGAGTCCCTCTCC
GCCTCCCAAGAAGAGAGGAGCTACCCCAGATCTCACCGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62