GenePrediction:GLEAN_6087 Details

Name: GLEAN_6087
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2404343..2401662 (- strand)
Length: 2682
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2404343..2404020 (- strand)
Length: 324
Type: CDS
Source: GLEAN
Position: GCSC_144:2403958..2403694 (- strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_144:2403629..2403418 (- strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_144:2403360..2403338 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_144:2402428..2402244 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_144:2402178..2402146 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_144:2401948..2401902 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_144:2401835..2401662 (- strand)
Length: 174
>GLEAN_6087 class=GenePrediction position=GCSC_144:2404343..2401662 (- strand)
ATGGTGGAGTTCAAAGAGCCGATCGATGCAACTGTTGCTCTAGCGCTGAATGGTATATCTATGGAAGCTGAGGATGCTAG
CGGGAGTGGCCAAAGCGGACTTTCTATCCAGAGACCGAAAGATTACATTGTGCCTGCTGTTGTAGACTACAGTGTTTATC
ACCCTGGCGTAGTGTCGAACGTTGTTATCGACACGCCATTCAAGATTGCAATCACCAACATTCCTTCTTATCTCTCTGAC
GAGCAGGTTACGGAATTGTTGGTCTCTTTTGGCGAGCTTAGAGCTTTTGTCTTGCTGAAAGACAGAAGCACTGAGGAATC
GCGAGTAAGTTGTTTCTTTCCGGGAGAAGGAATGAGAAGTATCATGCCATCTAACATGTGGAAAGGGTGTTGCATTTTGT
GAATATACCGAACCGCAATCGACGGACGTTGCCATTCAAGGTTTGAATGGAATGGACCTTGGGGACAGAAAGCTCCGAGT
GCAGAAAGCAAGCATCGGCATCACTCAAGTCACCAGTGTCGAAATGGGTGTGAACGCCATGTCCCTCCTTGCCGGCACTA
TATCTCAAGAAGCGTCAGATGTTAGTCGTGTCGTCCAGCTCCTCAATATGGTCACAGCCGAGGAGCTGGTTAACAACGAC
GACTACGAGGGTAGGCAATGGCGGGGGCTGCTAAAATGAAATCATATTATTGATCTCGAACTAACGCTATTCAGATATTT
GCGAGGATGTGACAGAAGAATGCGCCAAATTTGGTCCGGTTATGGGCCTCAAGGTTCCTCGGCCGGCTAGTGGGGGCAGG
CACTCTCCTGGTGTTGGCAAGATTTTTGTCAAGTTTGACAGCAGAGATTCGGCCACCAAAGCACTCAAAGCCTTGGCGGG
CAGGAAGTTTTCTGACAGAACAGTTGTTGCTACATACTTTCCTGAGGTAAGTCTGTAGAACCATATATCAATCACACAAC
AACGCTAATCATGAATTTGCCAGGAAAATTTCGAAGTTGATGCATGGTAAGCAGTGAGTTGAAGTTGCCAGCAATATCCA
GCTGCCTGGTATGTCATCCTTTGGTTTGGTCATATCCACTACAACAGTATACTTTAAAACCTGGCACATCTCGTGTGAGC
TATGTTGAAAGCAATAGACCATGCAACATGCTATTAGTTTGGGGCCCATGGTGCCAAAAGAGCTTTAGATTATCATTTTG
GTTCGGCAATATGTGCCAAAAGAAATTTCCCGATTATTGCTTTCGTGTTCTTCAACGGCATCTTCAGTCATGTATCGGGG
TCTAAATAATTCTAAATATCATCGCATTCTACCAATATTGCGTATTTAACACTGCATGATATGACAGCACATTACTAATT
AATAGCCGAGTTAGCAATCAGATTGTTTGTAAAGCGTTGAGAAATTGAGACGAAAATGGACAGTCAGAAGTCCGCTTCAT
TCATTGAGTTCGAAGAACCCTAACATAAGAGGTACCAGAAAAAAAAAGTAGGTTGTGATCATCATGTAATCCATAGACAA
CAAGTCAAATGAAATGAGAGAACGCGACAAAACTTACCGAATAACTGTGGTTGCAACAAAGTAAAATAGCAGCCACCTTT
TCGAAATACATAAGAGACAGAAACTAGAATCAAGCTACGTCGTACTCCGATTTTTTTGCCAATTTAGCTTGCCTGACAGT
GATCGGATAATGTTTCGGAAGAACCATTAGTTGATCCGTGTGCTTTTTTTCTCCGCAAGCACTAATTTCGACCTGGCCCC
AATAACGGAGGACCAGATTGTGCGTGTTCTGATTCTCACTCATCTTAGTGGGTTTTTTTTTCTAATTTCCTCCTTCAAGA
AGATCGCCAACCTCAATTTCATTACTAGAAACCGTCAAGATATTTATAATATATCAAAATGGGTCGCCTTCACAGCAACG
GAAAGGGTATCTCATCTTCGGCGGTTCCCTACTCTCGCACCGCCCCGTCATGGTTGAAGACGACTCCCGACCAGGTTGTT
GAGCAGATCTGCAAACTTGCGAAGAAGGGTGCTACGCCTTCCCAGATTGGTGTTGTTCTTCGGGACTCCCACGGCATTGC
ACAGGTCAAGATCGTAACAGGTATGTATCAAAAATTGACACATCTGCACTATGCCGGCCCTCGTCCCTTTTCTAACAGTC
CATAGGCAACAGAATTCTTCGCATTCTGAAGTCCAACGGTATGGATTAATTATTCCCAAAACAATTATCGCAATCATAGA
ACACAAACAGCAAAAGGGGGAGATGCTCGAAACAACCAGTTGCTTGCACTACTTCAAAAAATAGCTGGATCCTGTGTTGC
TCGCAACTGCTCCTTTTCTGCTCAGCTTTATATTATGCCTCTAGTTGGTCACAGACTGACAGAGTGATGGTACAGGCCTA
GCGCCCGATATTCCAGAGGATCTGTACATGCTTATCAAGAAGGTACGTGCTTGGGCCTTGTACTGTCTGACTTTTCTCTG
CATGTAATTTGCTGCTAACTATGTGAAGGCTGTCGCTGTCCGCAAACATCTCGAACGCAACCGCAAGGACAAGGACTCGA
AGTTCCGCCTTATTTTGATCGAGTCGCGGATTCACCGTCTGGCTCGCTACTACAAGACCGTTGGTGTCCTACCGCCTACC
TGGAGATATGAGAGCGCAACTGCCAGCACGATTGTCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62