GenePrediction:GLEAN_6088 Details

Name: GLEAN_6088
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2394622..2393738 (- strand)
Length: 885
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2394622..2393738 (- strand)
Length: 885
>GLEAN_6088 class=GenePrediction position=GCSC_144:2394622..2393738 (- strand)
ATGGACGTCAAAGAACATGCTCTGCTCCTTCTGGAGTGGATCCTGACGCCATCAACACCCGTCTTCATCATTGGCATCAC
CATTGTCATCCTCTTCCCTGTCTTCCTGCACTTCTACCTTGCTCGATCTGTCCAGTACATCACCCTACCGTCTGTGGTCC
TCATTGGCCCCGCAGGGGCAGGAAAGGCAACTCTTGTCACCCTCTTTGAACGCCGCGATAAACCTGCATCTGCCCACACC
TCGCAGGTACCTATTGTTGTCGAGCTGGCCGTCTCCGAAGACGGCGTATCCAGCTTCCGTCAAGACCTCGACGCGTCCGG
CTCCACAGCGAAAAAGTTCTTGCTAATCGACACCCCCGGCCATGGAAAACTTCGTGCTTCTACGCTTGGCATGCTCTCCG
GCCCTTCGAGCACAAAGTCAAAGATCAAGGCCGTTGTCTTTGTGGTAGATGCCGGTGCCCTGGCTGACCAAGATGGTCTA
GCTGCCTCTGCAACCTACCTCTACGACGTCCTGCTCGCCTTGCAGAAGCGGATGAGTGCGGGTAGCACGTCCAGGGCCCC
ACCGGCAGTCCCAATACTGATCGCTTCAAATAAGGCTGACCTCTTCACGGCCTTGCCAGCGTCGCTCGTAAAGAGCAATC
TGGAGGCCGAGCTGGGCCGCATACGCACCACAAAAAAGAAAAGCTTGTTGGACAGTGGCGTAGGTGCAGACGAGGTGGAC
ATGGCAACCGAGAGCGACGACTGGCTGGGCGAGTACGGCTCGAACAAGTTTTCTTTCTCGCAGATGCGCGCGTTCGACAT
CGACGTTGATGTTCTGGGCGGCAACATTGTAGGGGACGGACCAGGGGTGGACAAATGGTGGAGCTGGATTGCACACAAGA
TTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62