GenePrediction:GLEAN_6089 Details

Name: GLEAN_6089
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2367800..2366900 (- strand)
Length: 901
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2367800..2367706 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_144:2367624..2367416 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_144:2367327..2366900 (- strand)
Length: 428
>GLEAN_6089 class=GenePrediction position=GCSC_144:2367800..2366900 (- strand)
ATGAATGGTTTTCGGCGCGGCTTTGCAACCATGACGACCTCGCTAGCATCGCTCAAGAAGTCCAATAAGATTGTCTGTAT
TGGGCGGAATTATGCGTAAGTACTAGTCATACCAATCCGCGCATTAGCTACAGTGTCTTGTTCGGATCCCTTGCTGATTT
TGTGTTTGCCTATTAGCGACCATATAACGGAGCTCAACAACGCGAGACCAAAACAGCCTTTCTTTTTTCTGAAGCCGCCC
TCATCCATTGTCTTGCCAGGCGGTTCTTGTGTCCAGCCCAAGGGTATCGATCTGCACTATGAAGTCGAGCTAGCTCTGAT
CATTGGCAAGACCGTGCGTGACCTGAAGCCAGATGATGAGCAGGGCGCCTTGGACGCCATCGAGAGTAAGTCTCATAGCT
ACGCCAGCTGCGTTTCCCTATTGAAAGCTTTCGGGAATTGTTCACGGTGCTGACCGTGCACTCGAATTTATAGGCTATGC
GCTTGCGCTTGATATGACCGCTCGTAACGTCCAGAACGAGGCCAAGAAGAAGGGCCTGCCCTGGGACATTGCCAAGGGCT
TCGACACATTCTTGCCGCTGAGCCACATTATCCCCAAGGCCGCCATTCCCGACCCACATAATATCGAGCTGTATCTTACA
GTCAACGGCGAGATCCGCCAGCAGGATTCTACTGAGTTGCTACTGTTTCGCATCCCCCGCCTTCTCAGCGACATCTCCAA
AGTCATGGCCTTGGAGCCTGGCGACCTCGTGCTAACGGGGACGCCAAAGGGTGTTGGCCGAGTTGTCCCCGGTGACGTGA
TGCTCGGCGGCATTCGCGTAAATGGAAAGGAAATTGAGGAAGCCAAGCTGGAGGTGCCCGTTGTGGGTGGGACTGGTGAT
TACGAGTCTTGTCAGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62