GenePrediction:GLEAN_608 Details

Name: GLEAN_608
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:924810..931000 (+ strand)
Length: 6191
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:924810..925759 (+ strand)
Length: 950
Type: CDS
Source: GLEAN
Position: GCSC_97:926130..926145 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_97:926380..926451 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_97:926525..926602 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_97:926660..928178 (+ strand)
Length: 1519
Type: CDS
Source: GLEAN
Position: GCSC_97:928791..929108 (+ strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_97:929168..930561 (+ strand)
Length: 1394
Type: CDS
Source: GLEAN
Position: GCSC_97:930908..931000 (+ strand)
Length: 93
>GLEAN_608 class=GenePrediction position=GCSC_97:924810..931000 (+ strand)
ATGAAGAAACCCCAACTCGAGCAGCTCCATATCGATCGCATACGCTTGTCCAGCACCCAAGCGGATGGAGACTCACACAG
CTCATTGCGACAACCTGATGCGGATGACCAGCTGCCTACTTCCGTAAGCAAATCCGGCCTCCACGTCTGTGACCCGCAGC
AGCAGCAGCAGCAGCAGCAGCAGCAACAACAGAAGATCGAAGAGAAGAACATAGGGCTTGAACAGTCGCTTCCTGTTTCG
GGCACCTCCAAACACCATGGCAGCCGCTTGCTTGGATACCTGCCCTGGGGCACCCGGGCCGGTGATCCGGCCGTTTCCCG
CAGCGACAGCAGCAGCAGTTCCAACAACAACGACAGTAGAAACCGTCACTCGGCAGACACACTCACACCACCGGTGTCCT
CGGCGTCAAAGTCGGCGGCGGCTGATACCGTGGAAAAAGCATGGCCGGGGCCTGTCTTAGAGGGGCCGGGTACACCGTCG
CCTCTACCGGAAGCATCGGCCCCGTCGGGACTGATAGAAAAAGATGCTGTTGGTGAAGCACACCATGCATCGACTTTGAA
CACCACCGATTATCAGGGAACTCAGGATGTCAACCAAAACGTTGATCAGAACGGCGTCGCAGATGGTGGTAGCAGTGAGG
ATAGTCAACAAGACCCCGAGAGAGGCATGGCTGGCAGAGTTGCCACTCTGGCTCGTAGTTTTCTCGCCACCGCTAGGAAG
ATCCTCCTCTATAGTTGGCTCAACCTTCTCCTCGTCTTCGTGCCTGTCGGCATCGCCGCTCACTTTGCCCACCTGTCAGT
GGGTGCCGTCTTTGCCTTGAATGCCATCGCTATTGTTCCACTGGCTGGTCTTCTAGCTTTCGCTACCGAGTCAGTAGCCC
ACCGCATGGGCGACTCTATTGGCGCGTTGTTGAACATCACCTTTGGAAATGCCGTGGAGCTGATTATTTTGTAAGTCGAT
TGTCCTTGTGCCTGACCTTCTTTCCACGCTAACATGTCCAGCATGTATGTCCTGGCCATTGATGAAACTCGAGACAAGAA
CGAGAGAAAGGGCTGCTGTCTACATGGCGCCCTTGTCAAACCAATCGCGTCGAAAGCTCAATCATGGTTCATTTTGTTTT
CCCGCCTTCTCGTACCTTGATTTCTTCTGGCTGTGGTGGCTCTCTTCCGTCAGAGCATTGCTGTCCGGCCCTTGGTTTTC
ATTCGCCAGGAATCCCCTCTTCTCCTGTTTTGCGACCAATGCGCTTTTGCCTAGTCTGTGTTTCGCCTCAATGTCCTCGC
GATCACTAACATCTGTCTGCGTGTGTCCTCAATGTAACAGAATTGCTCTCGTCAAGGTAAGTGTTGTTCTGCCGTTCTGC
ATAGCGCCGTCTGGTTCAATCGCTAACATTCTGTCCAAGAATGAAATTCGTATCGTGCAGGCATCGCTTCTAGGCTCCAT
CCTGTCAAATCTGCTTCTAATTCTTGGAATGGGCTTTCTTCTAGGCGGTCTCCGTTATCGCGAGCAGGTTTGTGTGCTCG
CATGACCGTCCGTGATTTGGAGCAGCACAATGCTGACCATGTAAATTCAGATATATAACAGCACTATCACGCAGATGAGT
GCCTGTCTGCTCAGTCTCAGCGTCATAAGCCTCGTTCTTCCTGTGAGTCCTTTTGTTGGATTTGTACGTCTGTTTTGGTC
TTTTCCCTTCACATCGCTGACAATACTCAAAACAGACTGCCTTTCATGCATCTTTTAGCGATTCGGTGAAAGCTGATGAG
GAATCGCTGAAAATCAGCCGTGGAACTAGTGTTGTAAGCCATGGACCATGCACACGCCTATCGTCCACATTGCTGACATT
TCTGATCAAGATCTTGCTCCTCGTGTATGGCATATATCTTCTGTTTCAGCTCAAGTCTCATGCGTACATGTACGAGTCCA
CGCCGCAGTACATCATCGATGAAGAGTCGACTCCTGGCCCGGTCGCTGCATGGCTTGATTCGTCGAGTTCGGATGACAGC
TCCTCATCGTCATCCGACTCGGACGGTTCGGGACACTCCCGCAGCACGATGAAGAAGCGGGTGCGCCGTGTCATCCGTGG
TGGGCGCCGACGTAAGTCGAGCGTCGTCTCGCTGGATACAACCGAAGGCATATTTGGTGGGCCGACGCGTACACCGTCGT
TTGGTACCGCCATGGTTGGAAATGACGGGCTACCGATGCACCAAACGTCGGTGCTGCACCTTGCAACCATGGACATCAAC
GAAGACTTTATCGACGAGGACGATACAGCCCACAGCCGACATAAGAAGCGCAACCACCGACACTCTCTCCGGCGCCACCG
TCACAAGTCCAAGAAATTGAGTCGGACGGGATCCAACGAACATGATTTCGTCGACGAGCACAGAATCCCAGAGGCTGTCA
CTGTTGCACAGAAGCAGGGGAACTGGAAACATGAAGCTCGTCGCGGAGATAATATCTCTACTCGCAGCGAAAGAAATGGC
GAGGGTGGCAGTACCCCGGCGCGAGGAGAAACACGCCACGTCGACTTTGCTTTTTCTGGCCCGGAGCAAAATGTCGGCAC
AGAAGAAGACGGGTGTGGCAACACGGCGACTGCAGCAGAACTTTCCGCCCGGCCGGCTTTCAATCTGCGGGCAATGTCGT
TGCGACCAGTGGCGAAGAGCCTGACTCCAACGGTATTCAAACAGGCAGCTGACGGCTCGGCAGCTCTGGCGGTGCCAAGC
GGCCCCATACCGCGGGTTCGTTATGGGATTCGGCGTACAAACTCGCTTCCAGACCGGCTGAACCACATGCAGTTTCGTTC
TCCTGGTGCCATGCTGCCGTCACAGATTTCAGCCTCGCGTATCGCAGCTCTGTCTGAAAACAAGGACAGAGCGAACCATG
ACGAGGAAGGGTTAATGCTGTCTCGACGGGCCGCCGTGGTGTTGCTACTGATCGTGACTGCTCTGGTGGCCGTGTGCGCT
GAGTTTATGGTGGATTCGATTAACGGACTGGTGGAGACCAGCTCGATTGGCGAGGTGTTCATCGGCCTGATTATCCTGCC
TATTGTGAGCAATGCAGCCGAGCATGTGACGGCTGTCACGTGTGCACTTCACAACAAGGTTGATCTAGCCATTGGGGTTG
CTGTGGGCAGTTCTATCCAGATTGCGCTCTTCACGACGCCCTTGGTGGTGATTATAGGCTGGATCATGGAGCGTAAGATG
ACGCTCTATTTCACGTTGTTTGAGACGGTGTGCCTGTTTGTGTCGGCCTTTATCGTCAACTTCCTCGTGCTGGATGGACG
CAGCAACTACCTCGAGGGCGCATTGCTGTGTGCCACGTATGTGATTATCAGTCTGGTAGCCTTTTACTACCCGAACGCGG
AGGAGGCCAGTGTGTGGGGGCGATAAGCGTCTTCTGGCAAGTGAATGGGCAGAAGCATTCTGCTAGCAAGCAAAACGGAG
GATTGGCCTAAGGGAGTCGAGTACGAGGCGCAATTGCGCTTATGGGTGAGAGAAACTGTCATTATCGAAACGTTGCCAGG
TGTGTTTGGCTGTGTGGGGAACAGAGTACTGTCGTTATAGCTTCTTATCTTTTTTTGTATCTTTGCAATTTCGGAACCAA
ATCCACTCTTTAACTCGTCGTGTACTCCGTTCTGACGTCGCCATCCTCTCAGCGAATTGTGGCATCGGCTCGAAATGGCA
TCATCTTCTCTGCTGCTGCTATGTCTTACCAAAGAACCCGAAATGTGGACCCTATGCCCCGCTATTTTCCGTGAGCGGAG
AACCCGAACGGTGGATTCGTGCATCCCGCTGAATTGCTGTAGACCGGGACATGGATTTTTTTCGCACCTCTCGAGTGTTT
TTCCACTGACCTAGCATGCGGCGACTGGCTCGGCAGCCATATAATATAATACCTTTCAGAGGCTCTGAATTGTGCAGCCA
GTCACGATAACAATTGAGCTGGTCCGACGGCTTTCTTAATTGCCACGACCGCTTCGATCAGAGATTCTTGCCTGCCTCAT
CGACGGCATGCTGAAGCACCTCAGCCTGCGCAGCTCGCGTGCTGCTGCCGCATCACGGGCCACCGAAGTGCACAGCCTGT
CCGCACGACAGCTGCCGCGGGTACAGGCGTGTTTCTTCGCATCCAAGCCGCCTCAGCAGCCACCATCTGGCAACGGCGGA
GATCATGACGGCCGCAGTTTTCGCGGACAGATGGTAGAGAGCATCACAACTCGTATGGCTCGGGAGAAGGCACAGCGCGA
GAGAATCGCACAGGAGCGGCAAGAGTCGGCGACGACGCGCAATGCGGCGACGACATTCAGTGAGTCGGCAATGGTTTGAC
GACGCTCTTCAGAATACTGTTGCTGACACCGGTGTCAGTGATCTTGTTTGTGGGCGCAGCTTGCTATTTCCTCGGCTACA
AGGCGCCGCGGGACCCCGACCCCGAATCGACGATGTCGCTGGAGAAGACACGGCCACCGCGGCACAACACGAACCGGTCG
GAGCTGGAGGCTGCGTGGGCAGATTTTGTGGCGATTCTGGGCGAAGAGAACGTGAGCACAGTACAGTCAGACATTGACTC
GCACACTTCATCGGACTGGTCGTCGTACCGGCAAGAGAAGACGGTTGAGAGTGAAAAGGCGGCGGCGGCTCGACGGCTGT
TCTGTGTGGTGTATCCGAGAACCACAGAGGACGTGTCGCGCATCATGAAGGTGTGTCACACGCGGCGGATCCCGGTGACC
GGGTACAGTGGCGGGACGTCGCTGGAGGGCAACTTTGCGCCGACACGTGGTGGGGTGACGGTGGACTTCTCGCGGCACAT
GGACCAGGTGGTAGCGCTGCACAAGTCCGACCTGGACGCGGTGGTGCAGCCGGGCGTGGGATGGGAGTCGTTGAACGAGC
AGCTGGCGGATGAGGGGCTGTTTTTCCCACCGGATCCGGGCCCGGGGGCACAGATTGGCGGGATGATCGGCACAGGCTGC
AGCGGGACAAATGCGTACCGCTATGGCACGATGCGCGACTGGGTGTTGTCGCTGACGGTGGTGCTGGCGGATGGTACGGT
GGTGCGCACGCGGCAGCGGCCACGGAAGAGCTCGGCGGGCTATGACCTGACCCGGCTGCTGATCGGGTCCGAGGGCACGC
TGGGCCTGGTGACGGAAGCGACGCTGCGGTTGGCGGTGCGGCCGACGGCAACGTCGGTGGCAGTGGCGGCGTTTGGGACG
ATCCGCGAGGCGGCCAACTGTGCGGCGCGCGTGGTGGGTGAGGGTGTGCCGGTGGCCGCGATCGAGGTGCTGGATGGCCC
TCAGATGCGGTGCATCAACGCGGTCGGGGCGACGAGCCGTGCGTGGGCCGAAGTGCCGACGCTGCTGTTCAAGTTTGCTG
GCAGCTCGTCGCGGGCGTTGCGCGAGCAGATCGACGTGGTCAAGGCAGCGGCGACGGCGGCGGGCGCGCGCACGTTTGAC
TTTGCCCGGTCCGAAGCTGAACAGGCGGAGCTGTGGAGTGCTCGCAAGGAGGCGCTCTGGAGCACGTTGGCGGCATGCAA
GCCCGGTCAGCGGCTGTGGACGGGCGACGTGGCCGTGCCTATCAGCCGACTGCCGGACGCCATCGAGGAGGTGCAGGCGG
ACTTGCAGCGGCTTGGGCTCGTCGGCACCATCGTCGGCCATGTGGGCGATGGCAACTTCCATGCCATTGTGCAGTATGGG
CCGGAGGAGCGCGAGGCGGCCGAGGAGTTTGTGCATACCATGGTGAAGCGTGCGATTGAGCTGGAGGGCACCGTGACGGT
AAGTGGGAGAGAGCGGAGACGAGAGAGAGGGGAAGAGAGGACGAGAAGAAGAGGAGTGGAAGAGGGACAAAGATGAAGAG
ATGAAGAGATATGAAGAGGAGACACGATGCAGGCCCAACGAAGAAGGGCGAGAAGAAAGGAAGGAGCGAGAGGAGGCACG
AGGAAAGAACGATTGCTGACCAGTACAGGGCGAACATGGCGTCGGTATGGTGAAGCGCGACTACCTGCCCCATGAGCTGG
GCGAAGAGGCCGTGGCGATGATGCGCAAGGCAAGTGACCCTTCCCTGCTCCTTCCCTGCTCTGCCTGTACTGACTAGCCG
TCCGATTGGCCAATACAGATCAAGGCAGCCTTTGACCCGCTGTGCCTGCTCAACTGCGACAAGGTGATCCGCATGCAGAA
GCCGAAGCCAGGCGAGATTGGCCCATGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62