GenePrediction:GLEAN_6090 Details

Name: GLEAN_6090
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2365275..2364482 (- strand)
Length: 794
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2365275..2365207 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_144:2365133..2364950 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_144:2364812..2364668 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_144:2364599..2364482 (- strand)
Length: 118
>GLEAN_6090 class=GenePrediction position=GCSC_144:2365275..2364482 (- strand)
ATGGACCACGCACACCACCATGGCGCCAGTGCTATGGACATGCATATGGGTGACAGGTGCAGCATGAACGTAAGCTTGTC
ACCGTGGCTGGACTTCAGACTAGCTCTAGTACGAAGCTGAAAGGTCGACTGACCGATTCCAGATGCTCTTCACATGGAAC
ACGAACAACCTATGTGTCGTCTTCCGCTGGTGGCATGTCCGCTCGACATTCGGTCTCTTGGTATCGCTTCTGGCCATCGT
GGCATTTAGTGCCGGCTACGAGGCCCTGCGAGAGGGCGTGCGGCGCTACGAAGCGAAGACGGCCAGACAGACAGAGACGG
CACCGCGTAAGTGCCTACCTTCTTTACACGTTATTCTCTGTCATCTCGCTCCCTTTTTGTACTGTCGCCCTCTGCGATTC
TTTTCCCATGCCCAGTTACTACCCGCCCCCCCATACACCACACACACCACTAAGCCTGAGAAGACGAGGATCACGAACGC
GATGACCAAGATACTGAGACTACGCCTATCCTGCGCACAGGAATGGCTCAATCGCCAATCGCTAAGAGAGCGCATATAAT
CAAAGCTATGCTCTATGGAGTGCAAAATTTTTACGCGTTCATGATCATGTGAGTGCTTCGTTACAATGAAATGGACCAGA
GGTGGGTGATTACAGGGTGAAAGGCTGACAAAACAGGCTCATTTTCATGACATACAATGGCTGGGTGATGATTTCGGTGT
CCGTGGGCGCCTTCCTCGGCTACCTCCTGTTCGGCGGCTCGACGACGGTAACCAAGGAGACGGCATGCCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62