GenePrediction:GLEAN_6091 Details

Name: GLEAN_6091
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2358701..2356789 (- strand)
Length: 1913
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2358701..2358552 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_144:2358420..2356789 (- strand)
Length: 1632
>GLEAN_6091 class=GenePrediction position=GCSC_144:2358701..2356789 (- strand)
ATGCTGTTAATAACAAAGACTGTACTATCCTTCGCGTTGGTAGTCGCCAATCCTGTTGCCGCGGTGTGGCCGATTCCGCA
GAACATCAGCACGGGCGACACGACGCTCTTGATCAATGAGAACATTGCTGTCACCTACAATGGTGTATCTGTATGCTGGG
TTCTTTTCTCTGGCTCCCCGTGGCCGCCGTCCTGCTCAGTGGCAGGCGGTGACATAGGCGAATCCTCAAACAATTGGTGT
TCTAATTCTGCTGATCCTAATTCTTTTTCTCACTATAACAGCTCACATACACGCATGGATACGAGGCATCCGACATCCAG
AACAGCGAAAACATAGTACAGGGTGGTGTCTCGCGGGCGCTTGACGCAATCTTCCAAACCGGTCTCGTTCCGTGGAAGCT
GCACCCCAAGAACAGCCTCTCTAGCTTCGAGCCCGATTTGAAAACGAGCAGCAGTCTGGCGTCGGTACACTCGCTAGTTA
TCAAGCAGACGACCCTGGACACGACCAACACGACAAAGGCCAAGGCTGGCACGGTGGATGAGTCGTACGGCCTGACAGTC
AGCGTGGACGGGGTGGCCAGCTTGACGGCCACGACATCGGTTGGCGTTCTGCGGGGTCTGGCGACGTTTGAGCAGCTTTT
TTATGCGCACACGTCGGGCACGGCGTGGTACACGCCGCTGGCACCAGTTGTGATCAAGGATGCGCCCAAGTATAAGCACC
GAGGAGTGATGCTAGACGTGGCACGCAACTGGTACGAACTGACCCACATCTACCGGACAATCGACGCGGTGGCCTGGAAC
AAGATGAACCGGCTGCACCTGCACATGACGGACTCGCAGTCCTGGCCGCTGGAGATCCCGACAATGCCAGAAATAGCAGC
GAAGGGGGCATACCGGTCTGACCTGACGTACACATCGGATGACCTGAAAGCTCTGCAGCGGTACGCAGTAGCGCGTGGCG
TGGACTTGGTGGTGGAGATCGACATGCCGGGCCACATCGGCTCGCTGGCATTGTCACACCCCGAGCTGATTGTGGCGTAC
GACGCGTTTCCCTACTTCTGGTGGTGCGCAGAGCCTCCATGTGGGGCGTTCAAGCTCAACGACACGGCGGTAGATGCATT
TGTGGAAAAGCTTCTCGACGACGTACTGCCACGTGTAGCGCCGTACTCGGCGTACTTCCATACGGGTGGCGACGAGCTCA
ACGCCAACGACTCACGGCTCGACCCGGGCGTGGGAACGGATTCGAAGGCGGTGCTGCAGCCGCTTCTCCAGCGCTTCATC
GACGCCAACCACAAACGGGTACGGGCAGAAGGCCTTGTGCCGATTGTGTGGGAGGAGATCCCGTTGACCTGGAATGTGAC
GGTGGGTAAGGACACGGGGGTGCAGACGTGGCTGGGTGCCAGCTCGATCAAGGAAATGACCGGCCGCGGACTGCAGGTGG
TGGACAGCAACTACAACTTCTATTATCTCGACTGCGGGCGTGGACAGTGGCTGAACTGGGACAACGGGTTGGCGTACGCG
GCCGGCTACCCATTTGGCGACTGGTGCAGTCCGCACAAAAACTGGCGGCTGGTGTACTCGTACGACCCGGTGACGTCAGC
CGGGCTGACGGCGGAGGAGGCGGCGCTGGTGGCAGGCGGCGAAGTGGCGGTGTGGAGCGAGGCGGCTGACGGAACGAACC
TGGACGGGCTGCTATGGCCACGGGGAAGCGCCGCTGCAGAGGCGCTGTGGTCGGGCAACACGGATCCGGCGACAGGGCAG
AACCGCAGCCAGCTGACGGTGACGCCACGGCTGGCCGAGTGGCGTGAGCGCATGGTAGCCCATGGCGTTATGGCAGAACC
GGTGCAGATGGTGTGGTGCACACAGGCAAACAACTCGACCGAGTGCTCGCAGCCAACAGGACCGGGATACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62