GenePrediction:GLEAN_6093 Details

Name: GLEAN_6093
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2348697..2347506 (- strand)
Length: 1192
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2348697..2348607 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_144:2348545..2347646 (- strand)
Length: 900
Type: CDS
Source: GLEAN
Position: GCSC_144:2347579..2347506 (- strand)
Length: 74
>GLEAN_6093 class=GenePrediction position=GCSC_144:2348697..2347506 (- strand)
ATGCACTTAATCCAGCAGTTCAAATTGGCGGCAGCTCTTGTGGCCCTCCAAACCACAGTCGCAGCAGCATCATGCAACCC
CTTAGAAAGCAGTAAGCAAGGACGCAAGCTCTCTGGAATGCAGACAAGAACTGACACGCCCGCTCTGCCTAGCCGGCTGC
TCCGCTGACAAGGCCCTCGGCACGTCTATTAAAGTCGACTTCAGCCAGGGCAGCGTCAACTCCTTCACCGCCAACGGCTC
GCCGACTTACGGCTCCGACGGGGTGACCTTTACCATCACCAAATCTGGCGACGCCCCTCAGCTCAACAGCGTCTTCTACA
TCATGTTTGGCCACGTCCAATTTGTCATGAAGTCGGCGCCTGGTGCTGGCATCGTCAGTTCGCTGGTGCTGCAGTCCGAC
GACCTCGATGAGATCGACATGGAGTGGCTTGGCACCGACACGACTGAGGTGCAGACAAACTACTTTGGCAAGGGCGAGAC
CATCACCTACAACCGCGGCCAGTTTGACGCTGCCGCCAACAACCAGGGCGAGTTCATCACCTACGACATCGACTGGACGG
CCGACCGCATCGAGTGGTCTGTCTCCGGCACAGTTGTGCGTACGCTGCTGCATGCCGACGCCGACACGGGCCAGTATCCG
CAGACCCCGATGCAGGTGAAGTTTGGCGCCTGGGCTGGTGGCGATACAGCGACCAACTCCGAGGGCACTGTCTCTTGGGC
TCGCGGTCCCACCGACTTTTCTGATGGGCCCTTCTCCATGATCGTCCGGAGCATCGCCATCACGGACTACTCGACCGGCA
CCGAATACCAGTACAGCAACCAGAGCGGCGATTGGCAGTCCATCGTCGCCGTTGGCGGCGAGGTCGGCGTTAACTCGGGC
AGTGCAAACACGGCCACGGCTACTGCTGCCGTCGGTTCCTCTACGCTGTCACCCACCATTCCTGTTGGTGGTATTGGTGC
TTTTACGGCTACTGCCTCTGCTGAGACCATTCCAAGCGGCTGGGTCATGACGCCCAGCGGCAAAATCGTACCGGCCGCTT
CCAACTTGATCCGTATGTACTCTGCCTTTCTTAACCCGCCTTTCTGTTGGTACTGATTTGCTAACACTTTATTTGCAGGA
CCACCACACCTTGCAATCCTCGCCGTGCAGATCTGCGCGAGTCTTCTGCTCGGCGCAGCCTTCATCTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62