GenePrediction:GLEAN_6094 Details

Name: GLEAN_6094
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2341937..2340643 (- strand)
Length: 1295
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2341937..2341885 (- strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_144:2341648..2341023 (- strand)
Length: 626
Type: CDS
Source: GLEAN
Position: GCSC_144:2340969..2340836 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_144:2340771..2340643 (- strand)
Length: 129
>GLEAN_6094 class=GenePrediction position=GCSC_144:2341937..2340643 (- strand)
ATGCTGTCGAGAGCGGCACGGCCAGCTCTCAGAGCTGGAGCTTCGGCTTCCCGGTACGTGCAGCAGGGGAGGGCCTATTT
GGGGATAGGTGCCGGATGAGGGTAGGGGAGGGGGGGTGGGAGCAAACAATGAGGACTTGGGCAAATGAATAAGGGGGAGA
GATGAGAAAAGCGGAGTGCGTCTGGTCCGCGATTGTCGATGGATGGAGAGAGGGAAGAGAGGAAGAACCGGGGACATGGG
TAAATGGGGAAACGGAGAAGGAGACAGTGCTGACGATTGACGCCCACAGGTCTCTTACGGCGACGCCGTTGGCGACGTAT
GCGACGCTCCGAGAGATCGAGGGTCGTCTCAAGTCGATCCGCAACATCGAAAAGATCACGAAGACGATGAAGATCGTGGC
ATCGACGAAGCTGACGCGGGCACAGCGTGCCATGTTAGCGAGCCGCAAGTACGGCGAGACGTCGAACGAGGTGTTTGAGT
CGGCCGAGACGAAGCCGCTGGAGGCCAGCGAGGCGAGCGAGGGCGCGCCGAAGAAGACGCTGCTGATCGTGTGCAGCTCG
GACAAGGGCCTGTGTGGCGGCATCCACTCGGGTCTATCGCGCACGGTGCGCAAGCTGTTCGCGGAGGCGGCGCTGGCGGG
CGCGGCGCCGCAGACGTCGTACGACCTGGTGCTGCTGGGCGAAAAGTCCAAGGCGCAGCTGCAGCGGACGAACAACAAGG
ATGTGGTGCTGTCGTTTGCCGGCGTCGGCAAGGATATTCCGTCGTTTGCCGAGGCCCAGGCCATTGCAGACCAGATTGTT
CAGCTGCCGGGCGAGTATGCGTCCGTCAAGATCCTGTACAACAAGTTTGTCAATGCCCAGAGCTACGAGCCGACGGCCAT
CGAGGCTTTCTCCGAGGAGGCTGTCGCAGCCTCGCGTAAATCTTTGCTCTCACTCTTCTTGGATGACTTTGCGCTGACAC
GGCTTCAGCCAACTTCTCCGTCTTCGAGGTCGACGACTCCACGCTGCCCAACCTGCAGGAGTATGCCCTGGCCAACTCGC
TCTTCTGGGCTCTTGCTGAGGGCCACGCCTGCGAGCAGTCTGCCCGTCGCAACGCTATGGACGTAAGTGTCCCTAGTACT
GACTGTGCTTGTCATCGCTTTAGCACTGCTAACCGCTATTGCACAGAACGCCTCCAAGAATGCCGGTGAGATGATCAGCC
GGTACCAGATCCTGTTCAACCGTACGCGCCAGTCCGTGATCACGGGCGAGCTGGTGGAGATCATTACGGGTGCCACGGCC
TCGGAGGATATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62