GenePrediction:GLEAN_6095 Details

Name: GLEAN_6095
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2329301..2327964 (- strand)
Length: 1338
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2329301..2329116 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_144:2329042..2328886 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_144:2328818..2328433 (- strand)
Length: 386
Type: CDS
Source: GLEAN
Position: GCSC_144:2328365..2327964 (- strand)
Length: 402
>GLEAN_6095 class=GenePrediction position=GCSC_144:2329301..2327964 (- strand)
ATGCTCGGCGCCGGTACATATGGCATCGTCCGCGAAGCAGATGGTCCGACAGGGAAGGTGGCTATCAAGGTCATTCTCAA
AAAAAATGTGAAGGGCAATGAACAGATGGTCTATGATGAACTTGAATTGCTTCAAACCCTCCAACACGACCACATCGTCC
GTTTCGTTGACTGGTTCGAGTCAAGGGTAGGCATCTCTCGAGCCACCTCTCCTCCTTTTGTCCTCTCCATTTGCTGATGC
TTTGCGCTCACCTCGACAGGACAAATATTACATTGTGACGGAACTGGCAACAGGTGGCGAGTTGTTCGACCGCATTTGCG
AGCAGGGAAGGTTCACCGAGAAGGATGCCTCGCAGACCATCAAGCAGGTTTTGACCGCCGTCGATTACCTACACAACAAC
AACGTTGTCCACCGAGGTGAGCAATACAATGGTCCACTTCAGGCTTTGGATAAGCATAGACCTTACTGACCTGCATTATT
AAGACTTAAAACCTGAGAACTTGTTGTATCTCACGAAGGAGGCTGACTCTGACCTTGTCCTGGCCGACTTCGGTATTGCC
AAGATGCTCGACAGTAAAGACGAGGTGCTCACCACCATGGCTGGATCCTTTGGCTATGCGGCACCTGAGGTAATGTTAAA
GAAAGGACATGGCAAACCCGTGGATATGTGGTCGATGGGCGTTATCACATACACTCTGCTGTGCGGATACTCGCCCTTTC
GCTCAGAGAACCTACAGGATCTGATTGAGGAGTGCACGGCTGCTCGTGTCGTATTCCATGACCGCTACTGGAAAGATGTC
AGCGACGATGCCAAAGATTTTATCATGGGGTTGCTGCAGCCGAAGCCGGAAGATCGGTGGACCAGTGAAGTAAGCAGCCT
GTCCACATTCGCTCCTAGTATGTAGTTGACCTCAGTTTCACTAATCTGTCTTTTAGGAAGCCATGAAGCACAAGTGGCTG
AGCGGCGAGAACGCCACCGACCACAACTTGCTGCCCGAGATCAAGGCGTTCATGGCAAAGGCTCGTTTGCGCCGCGGTAT
CGAGTTAGTCAAGTTGACCAATCGCATAGAAGCTCTCAAAATGCAAGAGGAGGACCCAGAAAACTCGGACATGCCAACTA
GTGCCCCTCCGGAGATAGCTCAGCCTGTACTGGCGCAATCGGAAGGGACGCCGTCGAGTGACAGCGGCAGTGGTAACATC
ACGGGGAAGCAAAGACTGACCAATGCGGTAAAAGGAGCCATATTCCGGGAGGTCGTCTTGGCCAAGGTGCGCGAGATGAA
GCAACAAGAGGAGGTGCGCAAGGAAGTCGGCAAGCAAGAGTCAGCAGCAAAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62