GenePrediction:GLEAN_6097 Details

Name: GLEAN_6097
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2301400..2300706 (- strand)
Length: 695
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2301400..2301356 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_144:2301287..2300706 (- strand)
Length: 582
>GLEAN_6097 class=GenePrediction position=GCSC_144:2301400..2300706 (- strand)
ATGGCTAACTTTCTCGCGTCTATCTTCGGCACGGAACAGGACAAGGTAAGCAGTCGCGAGAAACCGACCGTGCAACGCGA
TCATAGCTGTGTGCTAACCCCCCCTTACTGTAGGTCAATTGCTCCTTTTACTACAAAATTGGCGCATGTCGCCACGGTGA
TCGCTGCTCCCGCAAGCATGTCAAGCCGTCCTACAGTCAGACGATCCTCATGCCCAATTTGTACCAAAATCCTGCGAACG
TTTCCAACGGCATGAACGCCTCTCAGCTGCAAAACCACTTCGATGCTTTCTACGAGGACATTTGGTGCGAGCTTTGCAAG
TACGGCGAGCTGGAGGAGCTTGTCGTTTGCGACAACAATAACGACCATCTCGTTGGGAATGTCTATGCCCGCTTCAAGTA
CGAGGAGAGCGCCGCTTCTGCTTGCGACGCCTTGAATGGCCGTTGGTACGCTGCTCGGCCTATATATTGCGAGCTATCTC
CTGTCACCGACTTCAGAGAAGCCTGTTGTCGACTCAATTCAGGCGAGGGCTGTGTCCGCGGCGGATATTGTAACTTTATA
CACCGCAAAAATCCGAGCGAAGAGCTCGACAATGAGCTGCAGTTGGCCACGAAGAAGTGGCTGAAACTGCGCGGCCGCGA
TGAGCGAAGCGTCAGCCGGTCGCCCTCTCCAGAACCCACCCGTCGGCGATATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62