GenePrediction:GLEAN_6098 Details

Name: GLEAN_6098
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2290184..2286212 (- strand)
Length: 3973
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2290184..2289400 (- strand)
Length: 785
Type: CDS
Source: GLEAN
Position: GCSC_144:2289242..2288705 (- strand)
Length: 538
Type: CDS
Source: GLEAN
Position: GCSC_144:2287108..2286212 (- strand)
Length: 897
>GLEAN_6098 class=GenePrediction position=GCSC_144:2290184..2286212 (- strand)
ATGGACCGTGACCATGGCACCGCGCCCACGCCTGGCCCGGAAGATAACCGGTCACGGAAAGGTCGTCTGATGGGCAAACT
GTTTGGCGGCCGCGATCGAAAAGTGTCCAACGAGCTACGTGGCGACGACGCCGAGCTCAATGCTTTCCTGCACGGCACCT
CGAACTCACCCTCGCCCTTAGCTGCCTCGACAGGCACGACGTTTGACACCTTCCAGGTCACACACAGCACTCCGCCCCAG
CTGGCGAAGTTGGACACACAATATGTCTCTCGCTATCCCAACGCCCTGCCTGTCGACCGTGGGAACTCCTCCCAGCAGAG
CCTACCGAGCAGCCAGCAATCTCGCAGCCCCCCGCCGAGCTACTCGGTGTCAAAATCTGCGAAGCGAAACAGAAAAGGGC
TTGTCGTCCGCTTTGCAGACTCGTATCCGGACATTATCGGCGAGGGCGGCGATGAGACTGAGGCACCGCCGATGGAAATT
GGCAAGCGACGACGTGCACGTGCAGCAAAGCTCGCCGTCTCACCGTTGCTTGGCATGCACAGCTTGGCCCGCGGAATCCC
AACGGAAGCACAGCCGGCGACGTTGCCGATACGCTCGCCGCTGCCCGGCCCTCCAACATCACAACGCTCTATATTGCAAC
AGTCACAGCTGGAGTCACAACAGCCGGCGGCACAACCGCCGCTCAGGCCGCAGCAATCGTATTTGCGGCCGTCTCCCGAC
GACGACAGCTTTCTTCCTCGTCCGCTGAGGAGGACTCAGACTGGCTTTTCGGCAATTTCGGTTCCGTCCTCGCCTGACGA
TGACGAGCCGCCGTCTCTGCCATCTCCGCCGTCTTTTCCCAGCTCGCCGGAACGGAATCCGTCTTTGTCTTCGAAGATCC
CTACCAAACACTAATCCCCCACCCGGCTCTTTTGATGGTCCCGTCTTGACCCGCAACGACAGCCGTCGGTCTTTTATCGA
GGTTCACCAGGCGGAAATGCGCGAAGCTGAGGGCCGTGCTCTAGCCAACGCCCTTCGCGCCGGTGTCAGCCCGCCGTCCA
GTCCGGAAGTCGAACAGAAGCGACCACCGTCGCCGAGCAGGAGGTCACCGGCCAAGGGCACACCCCCGCTGCTCCCCCCT
CCGCGACACCCAGAACATCGCGGGCCTATCAACCGCTTTGAATTCGACCCAACCTCGCCCTCGGCCGCGTCGCCACTTCA
GCGCATGCGTTCTGAGCGCCACAGGCCGCTGGCCCGCGACCCCAGCCCTGCATCCGACTCGCCTCCCACCCCGGCTGTGG
AACGACCATATAATGCTTTCCGGCGAGATGCTATTGGCAGCGTGTCTGTCAAGGACCGTGGGGCCTACGCCTTGGCCAAC
GCCCCCAGGGCAATGCAGGACACGTACGATGCAGCCCAGTCTGCTTCTGACGAGGCCTTTACCTTATTTGTCACCCGCAT
GCGCCACCTGTTCGAGTTGTTCCGCCTGCACTCCGAAACAGTGAGGCCGTTGGTATCAAGCACCTCGGAGGATCTGGCCC
GCGCGGCGTTGTGGTGGTTTTGTCATTGGTCGCATGGCTCTGGGAGAACGTCATGCGCGAGCGCTCGGCTGCGGGCGGCG
CACCGTTGTCTCGCGGTAGCGAATTTGCTATGCAGCAGGCGTACGCAGATTTGGCGAAGGCGTACTGGGTTCTGGAGGTC
GTCTTGCCGGACATTCTTGCCACGAAGCAGAGTCCAATGGATACCGAAGTAGGGCAGGTGCGTTCAGTCCTCGTGAACAA
TCTGCGCAAGCTAGCGACGTCAATGAAGCGGAACGACCTGCTGCCGCCCGAAGACGCCCTCCTGCCGCAGACCATCGACA
AGGCGATATGGGCCGTGTACCCTCCCGTCAGCTCCGATGTCACCACCCTCCTGTGGGGGAAATGGGGCTCGGGTCTGGCT
GCGGCGGCCTCGCCTGTCTCGGCGATGTCGATTCTAGAGACCATACCGGTATCGGACAATGGCCAGGATTTTGTCTTCAG
CCGCGTCTGGGCCGACGTGTATCTGACCGAGCAGGGCCGGGAGTCGTCGCACCAAGCACGACTTCACTTCCCCTGTCTTC
TGACCGTCGCCAGGCCTCAGAACCAGCCGACGCTGGAAGTGGTTATTGCGAGCCAGAATGGCACTGTGCAGCTGCGAGTG
CAGGGCAGGAAGAACCCAGGACCCATGTGGGAGGATGTCCGATGGCGCCCTGAAACGTTTGCATTTGAGTTAAAGATGCC
GCGTGGGTTTTTGCTCATCATCCAGCTGTCAAAAGCTGACTACGGGCTCCTGTGGAGCATGTACGACTTTGGAGCCAAGG
TGCACAACCAGCTGTATCCGCGCAAGGATGAGCATATTCTGTTCCGCTCAACGCTCAAGGCATTCCAGTACTTCGAATCG
GGACCTCCGTCGGGCAGCTTTCCGAAAGAAGCAGTGGCGGACTGCGATGTGGCGCTGTTTGAGAAGATCGTGTCGGAGAA
CGCAGCGACAGGACGGCGCAACTTCCACCGCGGCTTCCGGTTCGCCGTAGTGTCGGGAACGCGGACGCGTACGCTATACG
GTGCATCACAGTTGTACCTGCCAGAGGCGCCGGTGCAGTTCAGCTTCTTGCGCGGCGATCACGGCGACCCGGCGCTGCTG
CTGCGATTCGAGAATAACCGGTCGAAGGGCAGCATGGTGCTGTCATTTGGCAGGGAGGACGAGCGGACGCGGTTCCACAT
GTTCTTGGCCGACACAGCCTTGCAAAGCAGCGAGCGCGTGGTGGCTAACGTTCCAGTGACGTCGCTGCAAGTCCAGGCGG
TGGCAACGCCGAACAAGGCTGCTGCTGCCTTTGGGACCAACGCGCTCTCGGTGTTCAAGAAACTGGCTTTCAGCCGGCTG
CGGGTAATCAACGACGACGACGAGGCGGACACGACCAGCGCGGCGACGGTGCTTGCGGAGAACCTACGAATTATCATGGA
GTTTGGGGACTGCACGCTGACAGACCGGATCAATGTGGGGGCCCCGGGGGAGCTTCGGCTGCGGCTGGATGTGCGGGACA
GCAACTGCCTGGTACTGCTGCGGCAGCCACAGAAAGCCTGACGCTGTCGATGTCGGAGGTGCAGGTGCCGGCGGGAGATG
GGGCCGCGAATTGGCCGAGGGTCTGGGAGCGGTGGGGGCCGGGGTGACGTGCCGGGTGTTGCGGTTCCCTACGGTGGCCG
ACCTGCACGCGGTGCAAGCCGCGATCACGGGATACGAGGTGGTGTTTGACGGGATGGCGGCGACGTTTGCGATAGCGCGG
CGGCGGATGGTGGTGCCGATCCACAAGAAGTGGGAGGCGGGCACGACACGGATCCAGGTGGTGGTGCAGCCGGACACCAA
GGTGACGCAGCTGCTGGCCTTCTTCCAGGATTTCCACTACGGGCAGTGCATGGGCTTTGTGCTCAAGGGCACGGACGTGT
TCGAGGCGTTTAGCCGCAGCGGCAAGGCCGGGCTGAAGATTGACGATGCCAAGTTCCCGCTGCCACGGATGCGGACGGGA
GACAGCGGAGCGAACGGGAGCAAAGAGGGCGGCAGCGACTTTGACGAGACGGCCTTTGTGTGTCTGGACATGCCAGATCT
GCCGGGCGAGCACGATGACATCTCGATTTTGTTTCAAGAGGAAGCAGGCAAGTTGACGACAGCACTAAAATTTCCCAGCG
TTACGCACGCGCTAACAATGAGCAGAACGAGATCGGCTGGCGGCGTGTCTTCCCGCACGAGTGCGAAACACTCGTACGAG
CAAGAAACACTAAGATCAAAGGGCAGCGGGTGTGTTTTTGGGTTCCTGCATTTGAGCATCATAGATACCCTAGAGCGGGA
CACAGAGGGCAAAGGACCAGCAGCCAGTATGTCGATCAGCATGTTTAACGGTCTACCGATCTTCAGGGCCGGTGTGTTTG
GGGTAATGCAGCGCAGCAAATGTTTGTATATTGGGGTAACAGGGCATCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62