GenePrediction:GLEAN_6099 Details

Name: GLEAN_6099
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2280607..2279935 (- strand)
Length: 673
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2280607..2280198 (- strand)
Length: 410
Type: CDS
Source: GLEAN
Position: GCSC_144:2280126..2280045 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_144:2279988..2279935 (- strand)
Length: 54
>GLEAN_6099 class=GenePrediction position=GCSC_144:2280607..2279935 (- strand)
ATGACTTCCGCACCACACTTAACCGTGCTTTCCAGCCAAGATCCCACCCACGTGGCCGCCACCTGCGAGCAGCATGATCT
CTCTATAGATGAGTTCCGGGACCTGCAGCGCCAGAGCACCACCGCCGCCCAGAGCGCCTACTGCCCGTACAGCCACTTTC
CCGTCGGAGCTGCCGTCCTGACGCGCTACGGCATCGACACGTCGGGCACCGGCGCGCAGACTAGCAGTGGCCGCATCATC
CTGGGCGCCAACGTGGAGAATGCAGCATATCCCGTGGGCACCTGTGCCGAGCGTGTTGCTCTGGGCCGTGCTGTCTTCGA
GGGCCACCGCGATTTCAAAGCCATCGCTGTGCTGGCTCCGACGGCGCCCGCTGAGACGCCGTGCTCGCCATGCGGAATGT
GCCGTCAGTTGTGAGTGGAGAAGGAAGGAGAAGAGACGAAGACGGACATGACGAGGAGTCTACAAGCTGACAGTCCTGCA
GCATCCGTGAGTTCTGCGAGCTAAAGATGCCCATCATTATGTTCTCCAAGAACGGACATTACATTGCTGTCAAGCTGGAA
GGGGTACGTCCAGATCTAGTTCCTTCATTCGAAGCATCCTGACTAACACCTCTTGCAAGCTACTGCCTTTGTCGTTTGGC
CCAGAAGCCCTCGCCCCAGCAGCAGTGTCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62