GenePrediction:GLEAN_609 Details

Name: GLEAN_609
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:934659..935999 (+ strand)
Length: 1341
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:934659..934796 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_97:934859..935011 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_97:935250..935816 (+ strand)
Length: 567
Type: CDS
Source: GLEAN
Position: GCSC_97:935892..935999 (+ strand)
Length: 108
>GLEAN_609 class=GenePrediction position=GCSC_97:934659..935999 (+ strand)
ATGGGGGACTTCATATCAGTGCCTACAGTGGACTTTGGTTGTCTGCAAGACGAGGAGACCAAGCCCCAGGAACTTCTCAA
CCTTCGTGATGCTCTTTTCCGCGTTGGGTTCCTGTATCTTGTAAATAATGGAGTAGAGGTGAGTGGACAGAGTATCTGCT
GCAGCTAAAGATACCGAAGCTGGCTCTCTGACACCCGCAGCCACTGATCCGCGAGCTGCACGGGCATCTGCCAGCAGCCT
TTGCTCTGCCTGCCGAAGAAAAGGAGCGAGTCAACATGCGCAACTCACCGTCCTTTCTGGGATATACCGCCCTTGGAGCA
GAAACCACAGCGTCTAAAGCAGACTTGAGGGAGGTGCGACAGACGGAATATTGAGACAGCATAGAATTCACGTGCAGGGC
CTGAAGCTGACAAGTGGGCGATAGCAATACGATTTTGGCTCGTCTGTAGACTGTAGATGGAAGGAGGGAGATCCTTCCTG
GAAGAGATTGGAGGGTCCAAGTCAGGTATGAGTGTGACGCCCCGCATACAACTATCGATTCTCGTGCCTCTTTGGCTTCA
CGGCCCAGTTGCTAACTCAGAGACGAAACAGTACCCCAATCTGAAAAAATTCCGAGAAGCGGCAGAGCAGTACATGGCCG
CCCTGGATCGGGTGTCAAAGCTTTTCCTGTGCTTCGTGGCTGAGTCGCTGGAGCTGCCCCCGGACACGTTTGATAGCTTT
GTCGGACGGATGCACCGGCTCAAGGCCGTCAAATATCCGCCCAGCGCGCCGGGATCGCAGGGGGTCGGGCCTCACAAGGA
CTCGACCGGCCTCTTCACATTCCTCTCACAGGACGCAGTTGGGGGGCTGCAGGTGCTCAGCAAGGCCGGCGAGTGGATCG
GGGCGCCGCCGGTTGATGGAGCCCTCGTCGTCAATGTGCAGCAGGGCTTCGAGGCCATCACAGGAGGCGCCTGTCCGGCA
ACGACGCATCGGGTCATCTCACCCACGGCGACGGTGCGGTACAGCATCCCGTTCTTCCAGGCCGTGCGCCTGGACCTGAC
CAATGCACAGCTGCGTGCCTCGGCCGCCCACATCGTGGCGCGCATCCCAATCACAGACGACCGCCGGAAACGGGCCGTTG
ACGTTCCCAGCGAGTTCCTGTCGCCACTCTTTTCATGTGTATGTTGCTCGTGTGATGCCTGCCTCCTCCCCCTGCTTCGC
CAAATATTGCTCGTCACTGACACTAGCGCACAGTTTGGCGAGGCTCAGCTGCGCAACAGGGTCGTCAGTCACCCCGATGT
CGGAAAGCAATGGTATCCAGAGCTGTATGAGAGATACGTGGAGCAGCAGCTGCCGGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62