GenePrediction:GLEAN_60 Details

Name: GLEAN_60
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:404803..406633 (+ strand)
Length: 1831
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:404803..404813 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_179:404875..404921 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_179:404982..406633 (+ strand)
Length: 1652
>GLEAN_60 class=GenePrediction position=GCSC_179:404803..406633 (+ strand)
ATGTCGATCCCGTGAGTCAATCGTCACCTCGCCCGAGAGACCGGTCTGGACCGCTCACTGACCCTGCCGCAGCGCGGCCT
TTAAATCCTTTTGGCATTCCATGACCAGCAATGACCGCCGTACGTGACCCTCCGCCGACGCGCTACCGCGTCTTGTGACT
CGCTTCTGACAAGCTGCAGATTCCGAGTACAACTCTCCGTATCGGACTGGCCAACATGTGCCGCTCAGCTCCGAGAACCG
GCGCATGAGCGCCCTGGCCGCCGTGGCTACCGCCTCCGACTCGCGCGCCGACATCTCTTCTCCCTACTACACCGACGAGG
GCGCCCTCAGCCCAGCCATGTCCCAGCGTCCCCTCCGCAGTCCCGGCATGCCGCTGAGCCCGGCCCCCTACTCACCCGGT
GCGCGGTCGGAGAGCGCCCGGCGGGGTCAGCGAACCCACGACGGCTTCGAGGTCTCCACACCCAATGGCGAGATCCCCAT
GCAGGCGTTTCAGGACGGCCTGCCCCCACCGCCCCCCATAAGCCGCTCCTGGGAGCGCATCGACAGCTGGGCCGAGGAAA
ACTTCCCTGAACTGTTCGACAACCTCTGCGAGGGCTGCACCACCAACGACCTCAATGACCTCGAGCACATGCTCGACTGC
TCCCTGCCCATGGACGTCCGCGACTCCTTGCAGGCCCACGATGGCCAGGAGCGCGGCGGCCTGCCCACCGGCATCATCTT
CGGCTGCATGCTGCTGGACTGCGAAGAGATCGTCCAGGAGTGGGACAACTGGCGCAAGGTGAACTCGGAGTACCTGCAGC
AGTCGGCTGCCGCCGCTGCCGCCGCTGCTGCCGCCGCCGCTGAGGCTGCCAAGGCCAGCAGCGCCGAGGCTGGCAACGGG
AGCGTCGATGGCGAGGGCAGCGACGAGGCCTCCTCGTCCAAGGCCCCGTCCACCACCGCTGCTCCGGGCCGGCCCATGTG
GCGACAGGAGCTGCAGTCCCGCCAGGACTGCGTGCCCGCCAACGCCGTCCAGAAGGTCTATGCTCACCCGGCCTGGATAC
CACTGGTCCGTGATTGGGGTGGCAACAACCTGGCGATTGATCTGGCCCCTGGTCCCACCGGTACTTGGGGCCAGGTGATT
TTGTTTGGTCGTGACTACGATACCAAGTACGTGGTCGCGCGGTCATGGTCTGCCTTTGTTGCCATCGTGGCCGACGACCT
GAACAGCGGCAAGTGGTTCATCGAAGAGGACAGCAACGAGCTGAAGCTGCGCGAATTCAAGAACAGCCGGGTCGAGCCAG
GCTACTTTGACATTCTCCGGTGGCGGACGGACCAGAAGTTCGGCCGCCGTCAACCGAACCCGAAGCGGAAGTCCATGGCG
CCGAGCGTCGTCGCCTCGCCGACCGGTACTGGCTCGCCCTACATCAGCCCGACAGAACCGCCGTCAGAGCCCCGTGGCCG
GCCATTACAGCGCCTGAGCTCGCCGTCTCCGCTTGGCAGCCCCAGCCGGCCCGGATTTGGCAAGTCGCCCTTGGCTCGCG
TGACAGAAGAGGCTTCACTTCCCAGCTCGGGCGCCGCGTCGCCTAACGGCAAGGCTGCCGAGAAGCTAGTCGAGGTAGAA
ACGCCACGAGTGAGCAGCGATGCGAGCAGGCCTGCTGAGCCGGTCTCTCCCCTTGTTGCCTCTCCTGCTTCTGCTACGGC
TGCGGCTACCCCTGCCGCTGCTGTCGCTGTCGCTACCTCGCCGCTGTCCGGATCGCCAAAGGCAGCATCGGTCTCGAGAA
AGTCTACGCTCACAAACGGGACGCTGCAGGCGTCTGCGGAGGATGAGACCATGAAGACGATTGAGATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62