GenePrediction:GLEAN_6101 Details

Name: GLEAN_6101
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2274625..2273613 (- strand)
Length: 1013
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2274625..2274439 (- strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_144:2274262..2274105 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_144:2274008..2273613 (- strand)
Length: 396
>GLEAN_6101 class=GenePrediction position=GCSC_144:2274625..2273613 (- strand)
ATGACCGCTCCAGAATTGCAAGCCCGCCTCGCCACTCTACCACGTGCAGACGGCTCGGCCACGTACAGCCATGGCGGATA
CACCGTCACCGCCTCGGCCAACGGTCCCATCGAGGCCCAGAGACGAGACGAGGATCCCGATGCTGCCAATATCGACGTGG
TCGTACGACCGGCTGCTGGCGTTGGAGGTCAGCATGTTTCGAGTCTCTTCCGGTCGGAGTGGTCTCTCATTTCTCTACTG
CTCGCCCCCCTCCCCCCTCTCCTTTCCCTACCGTCTGTTCAAGCATACGATTTTTATATGAAGGGGCCTAGTCGATCTAC
AAATGACCCACGTGCTTACTCTCGTTGCTATACACATATATAGGTCCCAGCGAGCGCAACCACGAACTGATTCTGCAGAA
GACGCTGCAGGACATTGTTCTTGTGCAGGAGTTTCCTCGGTGTACCATCCAGGTTGTCCTGCAGATTCAGTCGGCGCCCG
AAAACGACTATGCCAACACAAAGCTCAACCAACCCGGCCTGGTACGTTGCTGCCGTCCCAAATGTGCCTTCCTTTCTCCC
GCCCAGCTCGCTCATTGTGCTTTCTTGAACCTGCCGGTTCTGCCGGTTCTGCTGCAGGCAGCCGTCCTGGCCCTGCTATC
TGCCAGCATTCCCATGCGCACCATAGCCACAGCAGCTGCCGTGGCCATTATGCCTGGGTCAATCATCAGCAGTCCGTCGC
CACGGGACGCAGCAGCGGCACAGTCTCTGCACGTGTTTGCCTTTTCCGGTCAGGATGACAAGCTTCTTCTGGCCGAGAGC
GAAGGCGCATTCACCATGGAGGAGTGGGACAACGCGCGGACAACTGCCGGGAAGATCTGCTGCGGACTGCGTGCCGGTAT
ATCTGGTTCAAGCGACAAGGCACTGGACGAGGAACACGGCACAGAAGCGACCGTGAGCATGCACGACTTTGTTCGGTCGA
CCGTGGTGCACAGAGCCGAAGATGTTCTCCAGTGGAAGCTGGATCGGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62