GenePrediction:GLEAN_6103 Details

Name: GLEAN_6103
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2258756..2255957 (- strand)
Length: 2800
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2258756..2258532 (- strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_144:2258099..2257902 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_144:2257816..2257607 (- strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_144:2257267..2257261 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_144:2257180..2257037 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_144:2256969..2255957 (- strand)
Length: 1013
>GLEAN_6103 class=GenePrediction position=GCSC_144:2258756..2255957 (- strand)
ATGGACCGGTCGAGAAGGCAGACACTGCGCTCATCACTAGTACCATCGCGCACGGATAGGAGCAGCAGAGCATCAGCCTA
TGGCCGGCAGTCCGAAGACAGTCACGATAGACATTCACAGGTCGATCTTGCCACCATTGAGCGGTCACTGAATCGTAGAC
GTGTTATCGAGGAGCTGATCAGAACAGAGGAGGGATACATTGGAGATGTTCGTTTCCTGATGAACGTGAGTTAGGCCGGA
CCATACCGAGAAAGCAGCTACTGGGATTGTCGATAATTGTCTAACGGGAGTAGGCATACTTGACCATATTAGCATCTTTA
CCGACACTGCAGGCAGGCCTGCGGTCTTCGATAAACCGAAACTTGACTGACATCGTCGAACTTCACGAGAGTCTCCCAAA
AGAGTTGTACAGAGTGGTTCCTGGCTCGGAGCATACACAAATCGAGCTCACCAAAAAAGAATCCGACGAAAACATCCAAC
GTAAACAGAAAGCAAAGCATGTATTCCTTGACAGAAGAGAACACTGGCGTGGCGTGGTTGCAGCATGTTCCGGGTATGGC
TTCCGATCCGGAAGTTGCCGCGCGAGTTGCTAGAGCATTTGCCAAGAAGGTAAGATGCCCTTGACGGCCCAAAACGCAAC
AAAAGCTAAGTCAGCAGATGAACCAATTCTTCATTTACGAGGAGTACGGGGCACAGTACGAGTTGATGTTTAAAGATCTT
CATGCCGCATACCGATCTGTTGCAAAATGGGACGAATACCAGAAGGGACTTGAAACATTGGGCTCTTGCATAGGCTCTAC
AAACCAGTCTCAAAACTCCAGAAGAGCGTTGACCATCAGCGATCTCTTGACAAAGGTACAGTTTACAATCAGCTTGTAGA
CAGTGTAATGTATTTTCTCTTTGAACGAGACAGCAGCTAATCCCACCTCAGCCTATACAGAGAGTTTGCCGCTACCCACT
GCTGTTCTCGGAACTGGTCAGGTACACCCCTGTGTGCGATTGCCCATACTCGTATATGGAGATTGAGAACACTTTGGCCC
GGTTAAGAGAGGTTACTGGGGCCATGAACAGGGCAGCGGATAGTGTCCTCGTCAGGGCGACTCTTAAGAAGACGTGGCTA
CTTCAGGATCGATTGGCGTTCCCAAATCAGGTGAGTGATCCGGTACAACATCTAGTTACTCGAGAGGACCTACTAATGAT
GTGCTTGAAAGCGATTTGATGCTTTGGCGAAAAGCCGAATTCGCTCTCTTGGCCACATACAACTCTGCGGAATTTTACAC
ATCTGCTGGCAGACGCAAGACTCCGTGAAAGGCAATTACATGGTGTGCCTTCTCTACCGCGACTGGCTTTGTTTTGCTGT
GGCCGAAAGGCCGGATCAGATCTATACACTTCAGGCCTGTCTTCCTATGTGTAGTTGCAATGTGGAAGAAGCCGATAATG
GTCGAGGTACGTGGCCTTCCCCTAACTGATATAACACCTGTGCTGAAAGGAAAAGGGTTGCAATGCCATACGGCGCCGTT
TTCATGGAAGCTTGTCTTCGAATGCGACTATCAGTTGTATGAAGTTGTAATGACAGCTTCCAACGCAAAAGAAGAGTGGG
AATGGAGACGAAGGCTAGAGCGAAACATGGTAGATGATGGCCATACTCAACCAGAAGCACAGGATCTCAGCTTCCTAGCG
TTGGACATCAGGACTCTTGGGACAGTGTTTGGAAAGCCTGGTAAGTTCATAATAGGACGTCAGCTTTGGGTGGCCGGAAT
CTCACGCTGTTGGCTGACATAACGAAGGCACCGCGGCTCGGAAGTTGTCGATACGTCGGGCAACAACAGTGGGGCCCAAA
TCCCCTTTATGCCAGGTCATTGTCAAGAACACCAGCTTCGATAAAGACAACCTGGCGATGCCGCCTAGGCAAGCGCCAAT
CAATCGCTCCCAGTCTCTGCAAGCAAATGCCCGGATCCCCGTACTATCACCTCCACGTTCAGACCGGGCTCGGCTTGAAG
CATTGATATGCGATGTATGGACGCGAGACGTGCTTTCATTTCCGGGAACGACGACGCGGACAAAGCCTGAGCGTCCTGCT
TTGTCCTCTGCCTCGTCTGCCATGAGAAAACTGAGCGTGGCCAGCCTGACCAGCACGTTTGGTCGGCGATCGATGGGCCG
GGCCAACACACATAAAAGAGCTGCAAGTTTTGACGTGGGTGCGAGCGAGACATATGTTCCATCGTGGCCTCTCAACCGAA
TGCATACAGATGGGGTTTACGAAAACGAGCAGCCAGCGGGCGAAGGACAGAGAACAGACAACGACACACCTACTGTCGGA
CATGCATCCTCGATGATGAACTTCGCGTGGCCAAGACCAGAGATTGAGCCTTCAAGCCCCATGCATACGGTTCCGACCAA
CTACATATCTCGAAGCGAGCCCAGTGAGACGAGTGCTATGGCCGGCTCGATCAAACGAACCATGTCCCGCTTTTTCGAGG
ATGGCTGGCAGCACCAGCCTCAGGAAGCTCAAGGCGCACAAATAAGTGATGGTAACAGCAATGGCGGCTACCAGAGCCGT
GACATGCCTCCCATCATTCGCGCAGCATACAGCGAACAATCCCTCCGCAGCGTGCAGTCGACAGGTCTTAAGGCTTCGCA
TGCCAACTCAACCTCCAGGCTGTCGACATACGCATCTGTGCATGAAAATCAACACCAGCCGACCAAGCAATCATCGATAC
GATCCTTGAGACGTTGGTCCAAGACAAATGTCTTCCACCGAACGTCACTAAGCCAATCTTTCCGCGGTCTTCTCCATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62