GenePrediction:GLEAN_6104 Details

Name: GLEAN_6104
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2255318..2254802 (- strand)
Length: 517
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2255318..2255158 (- strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_144:2255067..2254944 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_144:2254858..2254802 (- strand)
Length: 57
>GLEAN_6104 class=GenePrediction position=GCSC_144:2255318..2254802 (- strand)
ATGCGCGGTGAAGCCACCCAGAACAAGGTCCACTACCGGGGCTCGGATGAGGATTACATCGTCTTCGTCGATGATGTCGC
CACATATCGCAAATGGAAGGAAGATTCCTCAGTGCCGCTGGCACACTTTGTGTCGAGCTTCAAGGTATTTGTGACACACA
AGTAAGCTATTTTGAGTAGAGAAGCACTGCTCGTGCAGGTGCACTTGTACAAAGACATCGACATGCTGACACAGATACTT
CCCCTCATCAGTCAGGGAGTTCAGGGCACGTTAGACACGGCCTCGAACGGAACACTGGAAAATGAGTTTAGCACCCACGA
TATCGATGCCGTACTGAAATCTATTCTGTCCAAGGGAACACTGCAAGAGGTGGAGGTGAGCAACTTGGAATTCTCTGGCC
ATTCGTTGGCTTTCTCTATACCAAGTACTTTGGGTTGAACACACTTTGACATTCGCACAGGGTCCCGAGCGGCAGGGCTT
TAAGAACGACTCCCAGGGAGCACGGGTGGCACACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62