GenePrediction:GLEAN_610 Details

Name: GLEAN_610
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:944057..947088 (+ strand)
Length: 3032
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:944057..944355 (+ strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_97:944430..944456 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_97:944504..944867 (+ strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_97:944930..944989 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_97:945039..945274 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_97:945447..945504 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_97:945573..946253 (+ strand)
Length: 681
Type: CDS
Source: GLEAN
Position: GCSC_97:946306..947088 (+ strand)
Length: 783
>GLEAN_610 class=GenePrediction position=GCSC_97:944057..947088 (+ strand)
ATGACAGTCAATCTGGCCACGCTACAGACGGAGCAGAAGAACTCGCGGACGACCAATATCGACACGGTCTCGTCGCTGGA
ACTATGCCGTAAGCCGGTCGGCCCCTGCATGCTGGACATGGGGGGGGGGGATGCTAAATCGAGGCGTGTCGTTGTAGGAG
TGATCAATGCGGAGGACCGAACGGTGGCCGATGCGGTCGAGACGTGTCTGCCGCAGATCGCGGCGGCCATTGACGTGAGC
GTGGCCCATCTCCTGGCCGGCGGCCGGATCGTCTACACAGGAGCGGGCACGAGCGGAAGGTAGGCTGCGGCGTCCTGGCT
GAGGATCATGTGTATGTGTTTACTGTGTTTGCGAGCTCACACCGTTCTCCCAGGCTTGGCATCCTTGATGCATCTGAGAT
GTGAGTACCTCACTACCACCACTACCAACAGCCTGCTGACCATACAGTCCCCCGACGTTTTCATCGCCACCCGGCCAGTT
TGTCGGCTTGATCGCCGGAGGCGACCAGGCCATCCGAAATGCCGTCGAAGGTGCCGAGGACTCGGAGGCACAGGGCGCGG
CCGACCTCGCTGCGCTGTCACCGCCGCTCAGCAAGCTGGACGTGCTCATCGGCATCGCCTCGTCGGGCCGCACGCCCTAT
GTGCTCGGTAGCCTGAAGCACGCCCGGAGCGTCGGTGCGGCCAGCATAGGGCTCGCGTGCGTCCGGCCGAGCGCCTTTGA
CGGCCAGTGTGACGTCCTGATCGAGTGCGTGACTGGACCGGAGGTCGTCACTGGCAGCACCCGGCTCAAGGCAGGGACGG
CGACGAAGATGGTGGGTACTTGTATATTATGCATGGCCACCTGGACACGAATGATGGATGCTGACAGTCCCAGATCCTAA
ACATGATCTCGACCGGGTCACAAATCACCGTGGGCAAGACCTACGGAAACTTGGTGCGTGCCATTCACACCCGCTTTGAT
CCAAGACTTGCTGACAGGAAAGATGGTGGACCTGAAAATGTCCAACGAGAAGCTGCGCGACCGGGCTCGCCGCGTGGTGC
GGTCAGCCGTGCCAGACAACGCGGCCGTCAACGTGGAGCAGGATGACGTGCTGGACGGGCTGCTTGCGCGGTGTGGCGGC
GACGTCAAACTCAGCATCCTCGTGGCTGCCCTGGGATGCTCACCAGACGATGGTCGGACGCATCTGCAGGCCTCTGCAGG
GTCGCTGAGACGGGCGCTGTTACTAGGGACGAAATGAGACTCGGAGGTCTACCTCCTTGTCCAAGTATATACGTTATTGC
ATATAGAGCTAGAGAGCATCCCGATAGAATGTACAATGTGTAAAGCATCCTCGATTCTCAGCTGCCAAGATGTAAAACTC
TGCTCTTACTATCTTACATTCCCGGACCAGCTCAGACGACAGGACCCGTATCAGTCCCGTCCAGTTTAGCTGGACTAGTG
CTGCTGTGGTGTGCTAGCTGCAGATTTCTTCGCCTGTCTCCCAGACGGTTTTCTCAGCTAGCGCATCTGCTCTTAGTGCA
CCTCGACTTCGGGATATCCAGACACGGCCATTTCTACGACCGGCATTCTGACGAGTCAAGGAACAACTGCACCGCGCATC
AAGATGGTCGTCCTCAATGTCTTAGGGCTGAATTGTGGCACGAGTGTTGACGGTAGGCTGCGGCCCATTTTCTCCCGAAT
GACAGACAGAGCGACTAACGAGCAGCCAGGCGTCGATGTCGCCCACTGCCGGATCTCGTCTGACCAGTCGCTGAGCGATG
TCCGGATCGAGCTGCTGCAGTACACCGAGGTGGCGGTTGATCCGGCGATTCGATCGCAGGTCCTGCGTCTATGTCGGCCG
AACCAGGCCGGCGCTGCGGCCACGTCCATGGCCGAGGTGTGCGATCTCAACTTCGCGTTGGGCCGAGAGTTTGCTCGCGC
GGTCGAGCAGTCGGGCATCGACCTGGCCGCCGTCGACCTGATCGCGAGCCACGGTCAGACGCTCTGGCACGAGCCGGCGG
CCGAGCACCGGTCGACGCTGCAGATGGCCGAGCCGGCCGTGATTGCACAGCAGACCAAGAAGACGGTCGTCTCGGGGTTC
CGCGTCGCCGAAGTGGCCGCCGGTCGCCAGGGTGCACCGCTCTCGGGCTTCTTCGAGGCCTGTTTGCTGTCGGAGCCGGG
CGTGACGCGGAATCAAGCCAGAACCTCGGGGGGATGGGTGGGTTGGGCGAGAGAAGGGGGTGAATATGTGCATGTGCCCG
TTCTGACAGCCGACAGGAAACGCAACCGTTCTGCTGGACGCGACCAAGACCACCTCTACAGACCGGTCCTGCAGCTACTT
TGCCTTTGACACCGGCCCCGGCAACGTCTTTATCGATGCTGCCATGCGCATCCTCACCGACGGCCGCCAGCATTACGACC
GCGACGGCGAGCTCGGCGCACGCGGCGAGGCGCAGATCGACATCGCCGACGTCGACGCGTATCTCGCCAGCGAGCCGTAC
TTTGGCCGCCAGCCGCCCAAGACAACCGGCCGCGAGCTCTTCTCGGACGACGTGGCACGCGTCCTGGTCGAGCGGCTGCA
GGCCCGCGGCCACTCGCCCGAGGCCATCATCGCCACCATCACGCGCATCACGGCCGAGTCGGTCGCTCGGGCCTACGAGG
ACTTTGTGCTGCCGCACTTGGCCGCCGGCGCCGTCATAGACGAGATCTACATCTGTGGCGGCGGCGCCTACAACCCCAAC
ATCCTGCGCCATCTGCAGGCGCGGTTTCCGCTCAGCCGGGTGGCCCGGCTCGACCAGGCGCCCACGCGGCTTGAGGCTAG
CGCCAAGGAGGCAGTCCTGTTTGCCCTGCTCGGCTTCCTCTGCGTCTGCGGCCGCTCGGTGCCCGTAGCCGCTGACGCCG
AGACTACGGAGCCGGCCATTCTGGGCGTCGTCACGCCTGGCGACAATTACCGCGACGTCATGGCAGCTGTCGTCACGGAT
CCGGCCTTTGGCCGCAGTAGCACACTCGGCCGCATTCTCATGGTCGAGCCGCGACAGGCAGAAGAGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62