GenePrediction:GLEAN_6118 Details

Name: GLEAN_6118
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2147642..2146502 (- strand)
Length: 1141
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2147642..2147607 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_144:2147537..2147425 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_144:2147357..2147282 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_144:2147213..2147163 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_144:2147097..2146955 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_144:2146657..2146629 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_144:2146566..2146502 (- strand)
Length: 65
>GLEAN_6118 class=GenePrediction position=GCSC_144:2147642..2146502 (- strand)
ATGGGTGTCGCAAAGACGACAAGAAAGTTTGGCCAGGTCAGTTGCTGTCTCCCGTGGCTCGCAGAGAGAGAAGATCCATT
TTCTGACATTCCTTCCTCACGACAGGTGAAGCGCGTCATCGGCCAGAGAGATGCTCGCCTGAAGAAGAACAAGGACAAGG
CCGAGCTCGGCAACAAGAAGAAGGAGTCTGAGGAGACCCCAGAACTGGTCCGAGAAATGTACGCAACAGACAGCCGATAC
GCAGATGTTTGACTCTTGGCCAACCGGTGCTAACTGTCGTCACAGCCCACAACAGTCCGTCTCGCTCTTCCACATGGCCA
ACACGGCCATGGTTCCGCCATACCAAGTTCTCGTCGACACGGTTTGTCTCCTACGTATCCTTTGCTCAGATCTCTCAAAG
TGCCGACACTTGCTGACCTCTGGCTCCAGAATTTCCTCTCCCACACCGTCCAGCGCAAGCTGCCTCTATTGGAAACAAGG
GTGCGCCTCCTGCTCCCCAATGGTGCTTCCGAGGCCATCCGTATAACTGACACATGCCACTCCAGATGGACTGCCTCTAC
GCCACCTGCCGACCTATTCTGACCGACTGTTTCATGGCTGAGCTCGAAAAGCTAGGTCCCAAGTACCGCATCGCTCTCAA
GATTGCCCGTGACGAGCGCTGGGAACGTGCCACCTGCACACACAAGGGGTATGATTCATTTCTTGCTTTCTTTGCTCTAC
TACTGTCTTGCAGTTGGCTCGTGTCGTTAAAGGTCAACTTGCACTAACTCGTACGCCAGTGTCTATGCGGATGATTGCAT
ATTTGACAGAATTGTTCGGCATCGGTACGTCTAATAGGCCTTCCCGTCCTTTTTTTTTTCTTCGTGCCAATGCTAATTTA
TCTCAGCGTTGTATTTTTTTTCCAACTTTTAAATTTCTCCGACCAAACCCGTTATATCCTAAAATAGAGCAGTACATTGT
GGCTACCAACGATCGCGACCTAAAGCGGCGTATTCGCAAGGTTCCTGGTGTACCGTACGTTTTTCTCTCCCCGCCTCGAT
TGCGTTTTAAACGCCTTAACTGACCTTGCTTGTTAGAAATTATGAGCGTGGCTCGCGGCAAATACGTCATCGAAGGCCTC
CCCGACGCACCAGTGTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62