GenePrediction:GLEAN_6120 Details

Name: GLEAN_6120
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2129852..2124484 (- strand)
Length: 5369
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2129852..2129235 (- strand)
Length: 618
Type: CDS
Source: GLEAN
Position: GCSC_144:2129191..2126278 (- strand)
Length: 2914
Type: CDS
Source: GLEAN
Position: GCSC_144:2126222..2124484 (- strand)
Length: 1739
>GLEAN_6120 class=GenePrediction position=GCSC_144:2129852..2124484 (- strand)
ATGGATGCAGAAGACGACGTCACGGCCGTGTCGCGGCATCAGCGACGGCTGAGCGGTGCTTCGGCCGCATCGTCAACGAG
GCCGCGTGCCATCGACGGCACGGCATTCGCAGAGCCCGACACCTGCCGGATATGCAGGGGCGAAGCCACGCCCGACGAGC
CGCTCTTCTACCCGTGCAAATGTAGCGGCAGCATCAAGTACGTGCATCAGGACTGTCTGATGGAGTGGCTTTCGCACTCG
CAGAAGAAGCACTGCGAGCTGTGCAAGACGTCGTTTCGTTTCACAAAGCTGTACTCACCGACGATGCCGAAACAGCTTCC
GCTCTTCGTCTTCATCGGCCATCTGGCGAAATACTTTCTGCGCAATGTGCTGGTCTGGCTGCGCATCGGCCTGGTGGCTA
GCGTGTGGCTGGGATGGCTGCCGTACCTGACTCGCTGGGAGTGGTCCTTTTTCTTCTGGATCAGCGAGGAGGGCCTGATC
TCGCCACACGCCATGTTCGCTGGCGACGACGAATTCCTTCGCAACGCCTCGGCCCTGGCCACGGCCGCAGCTAGCGCGTC
CACGGCCGTCTGCCCGTCGAGCCCGTTGTTCACGTCCACCACAGCAGCCGCAGCAGCCGTCAGCACGGCTGTCGCTGCTG
ACACTGTGGCTGCGGGCGCAGTACGGGGAGAACATGGCGGCCGGCGTGTCCAAATTCTCGGCGGTCTTTGGGTTCCTGCT
CGACCTTGTCAATCCCGGGGAGTTTGCCTCGGCAGCGGCGTCCAACCTGAGCCGGACAGGCGGCGTCGCTGCTGCAGGCA
CGCTGCCACCGTCGCTGCTGAGCGAAGTGGGCTTTCTGCGGTCGCTGACACGGTACAGCTCGGTGAACTGGGGGATTATA
TACGCGCTGGAGGGCCAGATCATCACGATTCTCGTGATCGTGTGCTGCGTGCTCGTAATCCTCGTGCGCGACTACGTGGT
ACAGCAGCAGCCAGAGATCAACATGCGCGCTGCCTTTGCAGCGGCAGCCGGCGACGAGCCAGAACCGCTTCTGGCCCGAC
AGATCGGGGATGATGACCATGATGACCATGACGACCATGACGACCATGACGACGAGGACAGGCACGAAGACGACAACGAC
GATGCCACGGACTGGGAGATGGGCACCAACTCGAACTTTGGGGACGAGGCGCATGTCGAGCCAGAGCCGCAGGCCATACC
TGCAACGGCTAACCGGGCAGCTCTACAACGAGCGGCAGCTGAAGACAGCTTGCCGGCCAGGCCACAGGCAGGACCGATAC
ACACTCTCGCCGGAGAAGATTTGAATCACGCAACGTCAACATCGATACAGACCAACCGGCCGAGAGTTACGGTGGCAGAT
TTGCAGGACATGCCTAGCATGTCTAGCATGATGGAGGGAGTTCCCACAGTGCAGGAATACTTGCGGGTATACCGGGAGGC
AGGAGGTGATCCTGACGAGATACTAAGGATTGCGAGAGCAGAACACATGGAAGACCGACTGGAATTCTGGCTTCGGCTCA
CACAGCATGTGGCGGACAAGAAGAGACAGTCGGAGCAGGGCGTCTCAGAAGGGGAGGGGTCGGGTGCGGAGATGAGTTTG
ACGGTGCCAGAGAGCGGCACAGATGCAGCGGACGCGGCCTGGTCAGAGAAGTTGCCGTGGGGCGAGGAGTCTGGTGGCGT
GGCGGGCCCGTCGGCCTCAAATCGGACGGACGACGGCATCAGCAGTCGAGATGACATCAACGGCCAGACGCCCTACGACA
AGGGCAAGGAGAGGGCCGTTGACGAGGCGCCGGCGGCGGACACGAGCGTTTTTGGCGGCAGCGGCGGACTGCGTCCGCGC
GCTCACACAGACGGCCCACAGCGGACAGGAGGCCTCAACCCGCTCGCGTACAACACCTGGTCGTTCCCGGAGACGGAGTC
GGCAGCAGAAGCAGGAGCAGCGGCACTATCACCGTCGGAAGTGTGGGAGAGCAACGACGGCCAAGATGACGACGCGGCTT
GGGAAGACGCGTCAGACGAGGAGGAGAACAACCCGACGCCGAGCTCGACCGAGGTGGCGGGGGAGGAGATGAGAGCGGCA
GCTGATGAAGGCGGACAGACGCAAGAAGAGAACAGAGAAGCAGAGGCAGTGGTGGCCATGGTGGCAGCACCAGTCCCAGA
ACAAGCGGCAGCACCAGCGGCAGTACCAGTAGTTGCAGCACCCACACCACCACAAGCACCACCTCCAGCAGTTCGACCGG
CAAACTGGCTCAACCGAGCAGCAGACTTCATGTGGCGGGACCTGGAAAACATCGACCCGCTGGAGCTGATAGCAGCCGGA
CCAGAGGCGGGATTCGAGATGGACGAGGGCCAGTTCGAAGCGCTGGAGGCGGGCGACATGATGGGGCCGTTGGAAGGCGA
CGGCGAGGTGCTGGATGCGGCAGCAGCAGGCGGACTGGACGCGGAAGCGATCGAGGACGCCGAGGACCTGGAGGGACTGA
TGGAGATTCTGGGGATGCGGGGGCCGGTGACGGCGCTCTTTCAAAACGCCATCTTCTGCGCATTCCTGGTGACGCTGACA
CTGGTTGTGGGAGTGTTCGTGCCATACAACATTGGACGACTGGCAGCGTGGCTACTGGCAAACCCGATGCGGCCGGTGAT
GATGCTGTTCGGACTGTCACGGCTGCTGCAGGACGTGGCAGCGGCTGTTCTGGGCGGCTGTCTATTTGCGGTGTTCTACA
CGCTGCACGTGGTCGTGTCGGGCTGGGCGTGGGTGGCCGGGGAACGGGGGCCGACGACAGTGATGGGACACCTGGCATCA
ACGCTGTTTGCGGCATGGAACATGTGTGCAGGAGGTGCGCTGCGGGTGGTGAACAGCTTCTCGCTAGAGCCTCCGATTCT
GTCGGCGGGTGAGATGCGCAACTTCTCGGCCGTGAGCCACGAGGCGCTGCTGTCGCTCAAGGGCCAAGCAGTCTCGGCAG
CTGCAGCACTCGGCCAAGCAGCCATATTTGTGGGAGGGGGTGACTATGGCCACAAGCTGGCGATGACAGCCGAGACGATG
CAACAGGCCGTCATGATGACGTGGAGCGTGGTGCAGGCAGTGCCGGGATGGATGGTGCGGCCGGGATGGTGGGTGATCAC
GCTGGACGGCGACCGAGGCGGCGGGTCGGCAGTGGACGCCACGCTGGCCTTTTGGAACAGCGCCGATCGATTTCTGGCAA
CTGGACTGGGCTACTCGACGCTCTGCCTGGCGGCTGGGCTGTATCTCTACCGCGGCACGCCCTTCTCGAGCGGGGCGACA
GGTCAGGCGTGGGAGGCGTCCGTGATCGACGGCCTCAACCGGGCCAGTGGGGGGCGCAGGGTAATCCGGATCATCGGCAT
CGGGATGCTGGCCTTTCCATTATACCGTGGGCCGTTGCTGGGTGTGGCCCTGTTCCCGCTCTGTGAGGCGGCCACATTGT
CGTCGCGGCTACAGTTTGCGCTCAACTATCCACTGACGTCTGTCTTTGTCCACTGGTTCGTCGGGACCGGCTACATGTTC
CACTTTGCCCTCTTTGTGTCAATGTGCCGGAAGATTATGCGCCGGGGGGTATTGTGTGAGTCGAGTTCTGTTCCTTCTGG
TTTAATTTGATGACTAAGCTGACTAATCAGTTTTCATCCGTGATCCCGACGACCCCGAGTTCCACCCCGTCCGCGACGTG
CTGGAGCGCAACGTGGTGACGCAGCTGCGCAAGATCCTGTTTTCCGCGTTTGTGTATGGAGCGCTCGTCGTCGTCTGCCT
TGGCGGCGTGGTCTGGGGACTGGCCGTAGCCGCTCCCGGCGTGCTGCCCATCCACTACGCGTCCGACAAACCGGTGCTGG
AGTTTCCTATCGATCTGATGTTTTACAACTCGCTGATGCCGTTGGCCATTCGATTCTTCCGCCCAAGCGATGGTCTGCAC
GCCATGTACACCTGGTGGTTCCGCAAGTCGGCCCGCATCCTGCGCATCACCTGGTTTCTCTTCGGCGAGCGCAAACTGGA
CGAGGAGGGCGATTTGGTGCTGGCGGCTGGCTCACCACACCGCCGCGCTCCCTGGTGGCGCCGCCTGTTTCTGGAGTACG
CTGAGGCGGGCGACGAGGTTGTGCCCAAGACCTGGACAGACACGCTGGCCGGTGGCACCGCACGGCCACGATCTGAGATC
ACCAAGATCGAAATGCGCGAGCTGGCCGATCGCAAGAAGCGCCTGGTGGCCTCCGGACAGCTGGTCATCAACGGCCGGTT
TGTGCGGGCTCCGGCATCGGACCAGGTCAAGATCCCGAAAGGCCGGGCCGTGTTCCTCGAGGTCAGCGAAGACGAGGGTG
TGGTCAGCGAACGAGGAAAGACAGGCTCGACAGCCACAGCCGTGGCAGACGCGTATTTGCCGCCGCACTACCGCTTCGTC
TACGTGCCGCCACACTTCCGCGTGCGTGTGCTGCTGTTCATCGCCTTCATCTGGCTCTTTGCCGCGGCCACGGGCGTGGC
CTTCACGGTGGTGCCGCTGCTGTTTGGCCGACGGGTCTTCCAGCTGTTGCTGCCGGCACACATCCGCAGCAACGACATCT
ACGCCTTCAGCATCGGCATCTACGTGCTAGGAGCGGCCTCTTACGGCCTATGGCACGCGCGGGCTCTTCTGGCCAAGACG
ACGGCGGCAGCACGACGTGGACTGACGGCCCTGACAGCGAGTCGAGCCGTGCGCAAGACGGCTGCTGCGGTCACGTGGAC
GTTCCGGCTGACATACGCATATGCGGTGCTGGTGATCGTGTTTCCGCTACTGGCGACGGCGCTGGTCGAGCTCTACGTGC
TGATCCCGCTGCACACGTACATGGGATCAGACGGAGGAGACGACAACAGCAGCACGAGCGTGCAATCGCATGCCCACACG
GTGCGGCTGGTGCAATCGTGGACGCTCGGAGTGCTGTACCTTAAGCTGGCGGCGCGAACAGTGACGTCGTGGCACGATGG
CACGCGGCTGGCGGCGGCAGTGCGAGCAGTTCTTCGTCGTGGACAGCTGGACCCAGACGTGCAGCTGTTGACGCGGGCGT
TTGTGAAGCGGGCGCTGCAGTTGGGCACGGCGGCCATTAGCGTGCCGTTGCTGCTGGCCCGTGTCGTGGCTGCGTCTGAG
CTGGGCGCCGTGCTGGCAGCCGCCACGCCAGTCGGCGCGAGTCTGGTCTACCGTTTGAGCTTCCCGATCGTCGCCTTTGG
TCGCGGCGGCTGTCTGGTCGCTATGGGGTATGGTCGATGTGTTTGGGTCGTGGCGGGTGCGAATCCGAGACGAAGCGTAT
TTGATCGGCGAGCGGCTGCACAATTTCGGGGCTACAACGGGTCCGCATGGACGGAGGGGAAGAGGAGTGAGGGGGAGATG
AGGGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62