GenePrediction:GLEAN_6121 Details

Name: GLEAN_6121
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:2103222..2102383 (- strand)
Length: 840
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:2103222..2103197 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_144:2103078..2103064 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_144:2102990..2102912 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_144:2102847..2102756 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_144:2102688..2102667 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_144:2102481..2102383 (- strand)
Length: 99
>GLEAN_6121 class=GenePrediction position=GCSC_144:2103222..2102383 (- strand)
ATGGCCCCCATTAAGAAGAGCAAGAAGTGAGTGTCAGACATATTTCAGAAGCTCAGGACTTGACGCCAGCCGCGATTTGT
CTTGTAGCGGTCCTCGGCCATATTTTCTCATGGAAGCTGTTTGCTAACGTACATTTGTCTTTAGGGAAGCCAACTCCATG
TAAATATTTTCCCTCTCCGACCCGAATGGTTGGATCGACACTCCGGAACAGATTGTACTGACACTGTACCAGCAACTCGC
GCCTGGCGCTTGTGATGAAGAGTGGCAAGGTCACTCTCGGCTACAAGAGCACCCTCAAGGCTCTCCGCAGCGTAAGCATG
CCAGAACATGCAAGATAATGTTGCCGGACAATGGCTAACGATTGTCTCTATACAGGGCAAGGCCAAGCTCGTCCTCATCT
CCTCCAACACCGGCCCCCTGCGGAAGTCGGAGCTTGAGTACTACAGCATGCTGAGCAAGACCAACGTGTATGTCTCACCA
TCTCCTTTCTGTGTGGCATTTAGCGAACAGCAAACTAACCTGTCGTTTCTTCAGTCACCACTTCTCTGGCAACAACGTAC
GTATATGAACATGCAAACCCCGCGCTCTTTGCGCCGCGCTCCTATCGCCTTCTCCCAGTATCCAGCCCAGAGACGGCAAT
GGCGGTCGCCAGCGCCGTCTCTGGGCTTGCCCTGCGAAGAAGTCGCCAGTTCTTGCCGACTTTGGAGGGTTCGCCAATGT
GCTAACCTGTAAATGATTTAGATCGAGCTGGGCACCGCATGCGGTAAGATGTTCCGCTGCTCGACCATGGCTGTCCTGGA
CCCCGGTGACTCGGACATCCTGTCGGACCAGCAGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62