GenePrediction:GLEAN_612 Details

Name: GLEAN_612
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:953249..956722 (+ strand)
Length: 3474
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:953249..953376 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_97:953458..954186 (+ strand)
Length: 729
Type: CDS
Source: GLEAN
Position: GCSC_97:954328..956722 (+ strand)
Length: 2395
>GLEAN_612 class=GenePrediction position=GCSC_97:953249..956722 (+ strand)
ATGGACTTTATTCTTCGTGCGCTGGCGCTCAAAGAGGCATATTATCCAAGTGAAGGCAGCCGCAATCAGATCGGCACTAT
CGCAAAGAGCGAGGATCCCCAGAGCAGTTTAGCAATAATATTAGAACTGTAAGCCCCTCGCTAGTAATGCGCGAATGTCT
CCAGCGGGACAGCCTTAGCTGATGCCAGCTTTCTCTCGAATGCTCCCAGAGTCCAAGACTGGAGCACAAACTCACACCGC
TTCGTCCTCGAGCTTCTTCACAATGCCGACGAGAACACGTACGACGATGCCGACCCGACGCTCACCATGACCCACACGGC
CGACGGGCACTTCCGGCTTCACTGCAACGAGCGAGGCTTTTCGGCCAAGGATGTCGATGCTGTCTGCGACAACAACAGCA
GCGCAAAGGCCGCCCTGCGCACGGCTACCGGCGAGAAGGGCGTTGGCTTCAAGGCCGTCTTTCGCGTTGCCCACACCGTC
TGGGTCGTATCAGACCCCTACCGGTTCAAGATCCGTCGCTCGTCGCTGAAGCCCGAAGTCTCTCTGGCCCCATTTCCCGA
CGGGAGCAACACTGAGGATGGCGGCACGTACATGTATCTGGAAATAATCCCGGAGCGCAAACACGATGTCCGCACTGCTC
TGGCCCACTTCGAACCGGCCAACCTCATCTTTCTCAAGAAGCTCAAGCACATCAACACCACCGTGGATGGCGTTCGGAAA
ACGCTGTTCCTCCGGTCCGAGGACTTTGTCGGCAACCATGTCAGTCACATCAGGATCATCCGAAATCGCGCGACGCTTCT
CTGCTACAAGCAGTTCTGCTTCCACGTGAACCTCTCTGTGGCGAGATCTAGTCACCAAGACGAGACCGACTCGATCATCA
AGCTAGCCTTCCCCGTTAGTGAGGACTTTCAGGAGGTCGTCTGCCGAGACGAGAAAGCGTATGCATGTCTGCCTATAAGA
AACTATGGGCTGAAGGTATTTAAAAGACTGCCCTGATTCTGTCTCGCCGCTTTGCTAAAAAAAGTGTGAACCGTGCACTA
GTTTGCGATCAATGCCGACTTTGTCTTGACATCAAACAGAGAAGACATTCACGGCGACTCCGAGTGGAATCGACAGCTTC
GCGAACTAATCTCGGACAAGTTTGTCGAAGCAATCGAGCTGCTCAACAAGGAAGATTCGCAGCTATGCTATTCCTGGCCC
TTGCTCCTCTATTGGGCGTCGAGCTCCGGGCATTTCTTCCAGAGCATCATGTATGAGATTCTCGACAAGCTAAGGCCGTG
CCTTGTTCTGCGGACAGATGTCGGGAGGCTTGTGTGTCCGGAAGACGAAACGCTTGTCCGATTTCCAGCGAAATGGCGGT
TTGGGCCAAACCGAGAGCTGCCGGTCCCGAGCATTGTCGCCAGGTCTACCTACTTGTCGCACGAGTACGATGATCGATGC
TCTGAGCTAATCGGACTCATCGGCGTCCAAGAGATTGAACCGATTCGGTTTTGGGGCGACTTGCGCACCTTTACAAGATC
TGCCGAATTCGCACTGCAAGACGAGGACTGGCACATCCATCTCGCAGATCTGCTCAACAACGACAGCGAACTATGTCTAT
ACTCGAAAAGTCTCGACATCATCCCCGTGGAGGGTGGGGTTGCTCCGTGGATATCGTCCCTCAGTGGTCGGAACAACATC
TTTTTCGCCACCGAAAGGGACGGCAGCACCAGCTTGCTGCCTCAAGGTGTCGGGCTGTTGATGATTCCAGAAGCTGCGAC
TCGGGATGAGCGGAGGAAAAGATTGTTTGAAACATACGGCGCCAAGTACGTATCTGAGGAAACTCGCATGATTGCGGAAA
CGATCAAGGAAAAGCATGCCAGTGCCAACCTGAAGCGCGCCAACTTCTCTCAATGGACCACCAAGGATTTGGTGTCGCAC
CTCTCGTTTCTTTTTCGGAACAGAACGAGGGTCTCGATCCCGAAAGATGTTTGGGTCGCCACCAACGAAACCCCCCAACT
CGCATCCGAGACCTTTGCCAGGCCCCTTGAGATGGGCGGCTATCGTCTCTCTGTTTCTGCTCTTCATAGCAGTTACAAGA
CCGAATTTCCTGATAAAGAAGGTGACGACTTTCTGGACTGGATGGAGAAGGTTTTCAATATGCCAAAATCTGCACGCCTT
GCCGTATCTGACGGCATTTGTCTGTCCCTTTCGCCTGAGATGGCATATGTGGCTCAGAAGTGCAACTCCAGCGAGTTTCT
AAACTTGCTTCGCCAACACTGGGGAAAATACTCCGACGTCCTGACGCCGGACAAGCCTGGTTTTCAGAAAAAACTATGGG
ATGAGATCGTCAACACTAAAATACGCTGCCAAGACTCGCAATATCGCCCATTGAAAGAGACGCTCTTGCCATCAACCGGT
CTGTACAATCTCACTGATGTTGTGGTCTTTCCTTTTCTGCCAATACAGATCAGTTCCAGACACGACTGGGATTTTCTTCC
CATTTTGGGGGTGAAGTCACGAGCAGCCGTTGGAGATTGGCTGCGGTGCCTGTCATCCCTCAAGGATACGTCAAGTACGG
ATGACGTCCGGATGCACAAGCGGATCGGATCCGTGTACACAGAACTCCTATTCTATTGCCAGAGAACAGAGGATCGGAGT
AAAGCACAAGACGATGTAAAGTATGCCACTGCATTTCCGCTTTTTAAGCACGTTCAGAGCCTGAATGATCTGCCCACTGA
CTTCTTGAATAGAGCTCGATTCCAGGCCGAAGAGTTGATATTTCTCCCTGCCTCCTTTGGCCGGACAGCCACGTGGGTTC
GCGCAGACCAGTGCATCTGGTATGGGACTCGCGATTTCCGCCCGCGTTACGTGTTTCAACTTGCGGACTACTACCATACA
AGCTACTATCGGTTCTTTGTGCAAGTGCTCGGCATTGATGAGCATTGGAACTTGAGTCGACTACGATACGAAGCTGAGCA
TCTAGCTGGCGTCGACATGGCCAGCTTTGCAACAGAGGATTCACTGAGCTATATAGCCAGCCTTCTCGCCGAGATGGACA
TCAGAATTCGAGACTTGGACAAACAGGGTCTGGACAAGGACGAGTACCTAGAACCGCTCAAGCGGATTCCAATGCTGCCA
ATCCGGCCGGCAAACTCGACACGATGTTTTACCAAGCTCGCTACTGCAGCAGGCGTCGACGAGTGGTTCATTGCAGACCG
TGATATTTTGCACAATGCCTTTCTCACAAGCGTACCCCTGCTTGCCCCTGCTCTCAGACACACGGTGAACCTCGATGCTC
TACTCTCAGCTCTTGGGCTGGAGAAACGACGGCTGTCAAGAACTAGCCTGACAATCTCCCGAACAGATCCAAAGGAGACG
GGCAAAAAGGAGAAGGAAAGTAAAAAAGACAAAGAGGGCAACAAAAAGGACTCAAAGGAAAGCACCAAATATACCGCCTG
GTGGAGGGAAAGGGCCGTATACATTGATCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62