GenePrediction:GLEAN_613 Details

Name: GLEAN_613
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:966302..966998 (+ strand)
Length: 697
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:966302..966806 (+ strand)
Length: 505
Type: CDS
Source: GLEAN
Position: GCSC_97:966874..966998 (+ strand)
Length: 125
>GLEAN_613 class=GenePrediction position=GCSC_97:966302..966998 (+ strand)
ATGCTGTTTGTTGCTCTCGTCGCCATTGCTGGCGCCACCACCGTCGTCGCGCAGTCGACTGTCGCCTGTAAGATGACTGT
GGCTAAATTCAACGATAACTCTACCTGCGAGGACTTTGCCAACCAGTACAACCTGAACCTGAGCCAGTTCGAGGCTATCA
ACCCCAACGTGACTACCTGCCCAGACCTGCCCACTGGCGACTACTGCATTGTTGGAACTGCAGATGCCACGTATATTGCC
CCCAAGCAGAGTACAAACACCACGTTCATTTCGTACGTCAGCGGAGCAGCCGCCAGCATTGCCAACTACACGCTGCCGCA
TGCCGTGACCTCGGACTCGACCACGCCAACGCCCACGTCTGGCATCTACCCAACCTTTACCGGTATGCCTTCAGACTGCT
CAGCCTACCACCTGGTTGCAGCAGATGACACGTGCTCTTGGGTCGCTATGAAGTATGGCATCTCGCTTCAACAATTTTAT
GCCTGGAACCCTTCTATTGATTATGGTATGAGTCCGCAACATCTTGTACGCCTTGAATTTCCATGAACTTCGCTAATACT
TCAACACGACAGGTTGTGGAAATCTCTACTTGGGCTACTATGTCTGCGTTGATGTGCCGGGAGCAGTCCATACGTCCACC
TACAATGCCGCTACCAAGCCGGGCTCACAGCGGCCTACAGAGACGCGGTCTGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62