GenePrediction:GLEAN_6144 Details

Name: GLEAN_6144
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1982721..1981576 (- strand)
Length: 1146
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1982721..1982481 (- strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_144:1982428..1981888 (- strand)
Length: 541
Type: CDS
Source: GLEAN
Position: GCSC_144:1981831..1981576 (- strand)
Length: 256
>GLEAN_6144 class=GenePrediction position=GCSC_144:1982721..1981576 (- strand)
ATGGCAGCACCAGCCCCCACTCCGGCGCCGGCGCCCCAGGTGGTCGAGCGTGCCACCAGCTGCACCTTTTCCGGCGCCAA
CGGTGCCGCCGCCGCCAGTGCCTCCCAGCAGGCCTGCCCGACCATCGTTCTCTCCAACGTGGCCGTCCCGGCTGGCAATT
CGCTGGACCTGTCGAACCTCAAGGACAACACGCACGTCATCTTCGAGGGCGAGACCACTTGGGGCTACTCCGAGTGGGCC
GGTCCGCTCCTGCAGATCGAGGGCACCGGCATCACCGTGGAGGGTGCCACTAGCGCTACCCTCAACGCCAACGGTGCTCG
CTGGTGGGGATGGCAAGGGCAGCAACAGCGGCAAGACCAAGCCCAAGTTCTTTGCTGCTCACGGCCTGACCAACGCCAAC
ATCAACAACCTGCACATCCTCAACACCCCTGTGCAGGCTGTCAGCATCAACGGTGCCAACGGCCTCACCATCACCGACAT
GACCATCGACAGCTCCGATGGTGACTCGCAGGGCGGCCACAACACGGACGGCTTCGACATCAGCGACAGCACCAACGTCG
TCATCAACGGCGCCAAGGTCTACAACCAGGACGACTGTGTCGCCATCAACTCCGGCACTGAGATCACCTTTGAGAACGGT
CTCTGCTCTGGTGGCCACGGTCTTTCCATCGGCTCTGTTGGCGGCCGCTCTGACAACACCGTCCAGACCGTCACCTTCTA
CAACAGCCAGGTCAAGAACTCCGTCAACGGTATCCGTGTCAAGGGTACCGAGGGCACCACTGGCAAGATTGCTGGCGTCA
CCTACAACAAGATCACCCTGTCCGGAATCACTGGGTAAGTCGAGTTCAGCCCTTCCTCCTTTGCCTCGTACACGTTACTA
ACGTTCGCAGACACGGTATCCTGATTGAGCAGAACTACAAGGGCGGCGACCTTGTCGGCACGGCCACCAGCGGTGTCCCC
ATCACTGACCTGACCATCGAGCACATCATCGGTACTGGTGCCGTCTCCAGCTCTGCTTACGACGTCATCGTCACCTGCGG
CAGCTCTACTTCGTGCACTGGCTGGACCTGGACTGACGTTAACGTCACCGGTGGCAAGAAGTACGCCTCTTGCACCAACG
TCCCCAGCGGTGTCTCCTGCTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62