GenePrediction:GLEAN_6145 Details

Name: GLEAN_6145
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1976065..1975488 (- strand)
Length: 578
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1976065..1976004 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_144:1975950..1975488 (- strand)
Length: 463
>GLEAN_6145 class=GenePrediction position=GCSC_144:1976065..1975488 (- strand)
ATGCTGATTGTTAGTGCGGAGAAGGCCGCCGTTTCTGATAGCCATGCGGCCGACCAGCTTCGGTATGTTGTTGGCCGACC
AGATCGACAGAAGCTGTCACGGCGAAACCACAAAGGGGACGCCACCTGGACTGGTCCAATCGCCCAAGTCCGCCTTCCAA
AGCGGTCCAAGCCTTTATCGATCCGCTGATAAGAATACTTGTCTCGTCGGGCGAAAGCGCCTTGTCGGCGGACTGCGACT
TCCCTCTTATCGGCTCTACTCTTGCCGGTTGTGGCATGCTTTGGCACGCTGCCGGCATTACTCCGACACCTATGGCGCTA
TGGGCCAATCACAATAAGCTGCGCGCACTGCCGCTGGCGGATATGCCGACAATTTGCTGTTCGAAGCGTTTATCTCCATC
GCTGCTTCCGTCGCTCTTCCGTCGCTCCTCCGTTCTTATCTTCACGCCGATCGCAGAACATATTCGATACAGCAGCATTG
CCCAACCGAGCGCAGCAGTCCTCTACTTTATCTGTTCACCGGCTTTTGTCCTCCACGGCGGAGAATGCGCTTTTAAGCCA
CTGCCAGCTACTCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62