GenePrediction:GLEAN_6146 Details

Name: GLEAN_6146
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1971474..1969303 (- strand)
Length: 2172
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1971474..1971378 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_144:1971321..1971011 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_144:1970935..1970782 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_144:1970720..1970632 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_144:1970559..1970539 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_144:1970473..1970290 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_144:1970223..1970127 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_144:1969639..1969303 (- strand)
Length: 337
>GLEAN_6146 class=GenePrediction position=GCSC_144:1971474..1969303 (- strand)
ATGCCAAGCTCAGACGGAGCCGCCAAGCGTGAAGATGCCGAGACTGCTCAGCCCCAACGCCTCAAGTTTTGGGTGCTCAT
AGTCTCAGCATTCGCGGGTATGTTCTTGGTGTCTCTTGTAAATGGAAAGCCTTCTGCAATCTTTAGATACAAGAGCTCTG
GACTAACCACGGCGGTCGACAGGATAAGCTCATCATCTCAACTGCCATTCCTCAGATCACCGACACCTTCCAGTCCAAAA
ACGATATTGGCTGGTATGGAACAGCCTACTTGCTCACCAACTGTGCCTTACAGCTCGTGTTTGGGAAACTGTACAAGTTC
CTCTCGATCAAAAATACCTTCCTTTCGTCCCTGCTGCTGTTTGAGGTCGGCTCTGCCATCTGCGGAGCAGCTCCAAACTC
GATCGCGTTTATTTTCGGACGAGTCATCGCCGGTCTTGGTGCTGGAGGAGTCCTTCCTGGTGTTGTAGGTTCATGGTTCT
CACTGATCAACGGTCATTTATAACTCGGCCCGACGACTAACTGCGGTCACCCCAAACAGATATCGATCATCGTCCATGTT
GTTCCCTTGCAGAAGAGGCCGAAATACCAGGGCTTTTTTGGGGCCGTATTTGGAATTGCGTCCGTTCTTGGTCCTACCGT
GGGCGGTGCTTTCACCACACATGTCAGCTGGAGATGGTGCTTCTACATCAACCGTAAGTTGCACCCCCAAGTAAAGCAGA
AGCAAACTGCAACTGACACATACCTTTATTACAGTTCCTATCGGAGGCATGGTCATGATCCTAATATTCTTCTTCCTCAC
GGATCCCAGCCAATCTAGTCAAAAGTGGTCTCTCAGAGAAAAGGTGCGACAGGGGAATTTACTGGGTTTCATTTGTCTCG
TTCCAGGGATTGTATGCCTGTGTCTTGCTCTCCAGTACGGCGGCACTACCTACGCAGTAAGTATCTGAGAATCTCAGACT
CGCACTGTTAAATGTTCCTTAAGGCTGACAGACTGGCTTAGTGGAGCAATGGCCGCGTGATTGCCCTATTTGTTGTTGCG
TTTGTGCTCTTGATAGCCTTTGCCTTGGTCCAAGTCTGGCTTCCAGATCAAGCCATCTTTGCCGCCCAATATCTTCATCC
AACGCAGTATCGCGTCTGGCTTTTTGGGCCAGTATGTGTGTTGGCGCACATCAGACCCTTTTTTTGTGAGTATCCGGGTT
ACGTCATTTTAACAAAACTGCGTGCCATCAGCTGATACCTGACGCCTCAAGTGTACTATCTCCCCATCTGGTTCCAAGCG
ATTAAGGGCAAATCTGCTGTCCAAAGCGGCGTGGACCTCCTGCCTATGGTACTGGTCATCGCCGGAACGTCAATCATAAA
TGGCCAGATTATATCTCGCATCGGATATTACACGCCGTCGTTTTATACTGGGTCTCAGCATCAGTGCTATCGGTGCAGGT
CTGATCACTACACTAAGAGTTGGAAGCTCCGAGGGCAGGTGGGTCGGATACCAGATTATGTACGGCTTTGGTCTCGGCTG
TGCCTCTCAGGCTCCCAACCATGGCTGCCCACGACGGTGGTTGAAAAAAAAAAAACATCGCGATTGGTGCGTCACTGATG
TTCTTTGGGTGAGTAAAGCTATCTTTTCCCCTCCACCTTCCTAGCCACTGTGTGATGGCTAATTGTACCATCGTTCCGAG
CTTTTAGACAGACGCTCTTCGGTGCCGTATTCGTTTCGGTTGGGCAAAATGTGCTCTCCAACCAGCTGAGAAAACGGTTG
TCTAATATTCTTGGGTTTAACCCCAGATCAAGATACAAGCACTGGAGTCACTGATATCCTCGACACTATTCCAAGCCAAT
ACCGCCAACTAGCACTTCAAGAGTACAATGATTCGTTGCGTATTATCTACCAAGTCGCTCTGATAATGGCCTGTATTGCT
ATTCCGGGCGGTCTGGCTATGGAGTGGCATAGTGTTAAGAGCAAGGGTCCTCCACGAGGTTCTGAGGAGAGAAAAGGCGC
CGTCGAGAAAGAGCAACCTTTAGGACATGTCAAACAGCCGAAATCCCTGGAAGAAAACATCCCACCCTCTGCTGGAGATG
CCAACGAAACAGTCCGCACGCTGGATGACGTACCGGCAGATGAGCCGACGACTGGCAATAACAATAACAAGTACACCAGC
GCCGACAGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62