GenePrediction:GLEAN_6148 Details

Name: GLEAN_6148
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1950896..1949910 (- strand)
Length: 987
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1950896..1950665 (- strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_144:1950592..1949910 (- strand)
Length: 683
>GLEAN_6148 class=GenePrediction position=GCSC_144:1950896..1949910 (- strand)
ATGAGTCCCGGGCAGACCGTTGTAGACAGCTCGGCCGCTGCAATAGCCACCGGAACGACTGTGTCTGCCACATGGACTCC
TTTGGATGCCGCCATCGCGGCGGCTTCCAGCGGCACCGCTGCTCCTCCAAGACGGTCTGGAACATGGCAGTTCATGGATG
ACGACGACACCGATGCGGCCGATCGCACCGAGCGCCGGCGACAGCAAAACCGGCGAGCACAGCGCAATCACAGTGAGTTT
TTAACCGCTTTCCGTGTCTGCTGTCTTCGTCCAGTGTGCACCTCTTCTCACCAGCCGTCCGCAGGAAATCGCGTCAGGGC
GTACGTCTCCTCCCTTGAGCAACAGGTCGTCGATACCATCTTCCATGACACCGAAGCAAATTCTTCCTTTTCTGCCACCG
CGACGGCAGCGACTGCTGTAGCCGCCCAGGCTGACGTCATGTCATCGACAGCCACACACGCAACCGCATTCGACTCTTTT
CTCCTGTCCAGCGCGGCCACAACGGGGGCAACCGGCAACCTCGACATGTTCAGCACGCCCGTTGACTATTTCTGTGCGGC
TGCAGCGACCAGCACCACGACCCCCATGGACAGGATCACATCCACGGCTACTTCACCGACTCTGGGGGGCGGTAACTATG
CGCCGCCTCCGCAGCAACAACCCTCACACACCCAGGTGTCACAAACTATGAGCATGCCGGACATGTTCGCTCCAGACGGC
TGCTGCTGTGACTGTGGCAAGTTTGCATCAGCCATGCTCAGCCAGGCACAGGCCCATGGCCAGCCATGGCCAGCGAGTAT
GGGCATGTTTGGCGGCATGCGGGACTGGCACGGGCCAGCCATGTTTGGGCACGGCGGACATGACCATGGCCACAGTCATA
GCCACTGCGGTCATGGTGGACACGGCCACGGGAGTCATGGAGACGGCGGCGGCGGTCACTGCTCATCCCTGCGAGAAGCC
ACTACCACCACCGCCTCCCCCAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62