GenePrediction:GLEAN_614 Details

Name: GLEAN_614
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:969384..970937 (+ strand)
Length: 1554
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:969384..970376 (+ strand)
Length: 993
Type: CDS
Source: GLEAN
Position: GCSC_97:970455..970937 (+ strand)
Length: 483
>GLEAN_614 class=GenePrediction position=GCSC_97:969384..970937 (+ strand)
ATGAAGAACTGCTTTGAAAATCACACTGCCTGCGGGACGCCTGACAGTAAGCCGTATGCACCTAAGCGCTTCATCGACGT
GCGAAACGACCGCGTCGTGCTACGAGAGAACGTGAAGGTGGCGCGCTATGATTGCCTAAGCCACTGCTGGGGACCAAGCC
AGAGTCCCATAAAGACGCTAAAGAGCACTTTGGCCGACTTTCAGAGTGAGATTCCGTGGGCCCAGCTCAGCAAAATGTTC
CAGGATGCCGTGGACATTTGCCGGCGGCTGGACATTGACTATCTGTGGCTCGACTCGCTATGCATCATTCAAGATAGCGA
TGGCGACTGGAAGGAGCAGTCGGTCCTCATGGCGGACATATACCAGAATGCACTGATCACAATTGCCGCTGCCAAAGCCG
GCGACGGCTCTGCGGGCTGCTATTCCCAACGAGACCCGGGCTATCTCGACCTACGTACGGTGGTACTGGGGCGGGTATAT
ACGCGTAAATGTGCCCCAAGTTCTCGCCGCTTGAACGATTTGCCGCTGCTACGCCGCGGATGGGTTTTGCAGGAAATGTT
GTTGTCGACCCGCGTGGTGTACTATATGCATCAAGAAGTGGCCTGGCAGTGCCGTTCGTGTTATGAGAGTGAGAACGGCA
ACACCGAGTATCCAGTAGATAAGTGGATGGGGCCATTGGAATTGATACATAAAAAGGTCCCGCGGGTGGAATCATGGCAT
CAACTCATTAGCACATATTCGGCGCTCCAGCTCACATTTGATAAGGACCGCTTGGCGGCACTCGCATCCATCTCCGAGCG
GTTTGACAAGGGAGCTACGGAGAAGGGAGCCACGGATAGCCAGTTTTTAGCCGGTCTCTGGCAGCCAACACTGCTGCAAG
ATATGGTCTGGCTGGTCGGCGACCAGAGTACGTCCGGCCAAGCGGACAAGAGACCCGAGCATTGGCGGGAAAATGGTGTG
CCCTCGTGGTCGTGGGAAGCTGTCCGAACGAAGGTGAGATAGAGGGACCAGGAATCGCTGGAGCAGCCCGTAGAATGCAC
TACGATTGTCAGCATCGACGTGCATTCGCAGGACAAGCCCTATCTCGGAAAGTTCACTAGAAGTGACATCACCTTACGCG
GGCCGCTGCTCCCTTGTCATCTTGACGATCTAGAGGCCACGATGCATCAGCGCCTGACCAATGGGAAGGAGGCGTTCCTG
TTTGATGACACTATCCGTGTGACCCTGTTTTCGCCTGATTATGGCTACAACGAGGCCGGACCGGACCAGCTTGAGAACGA
CAGTGCGGTGTTCCTGCTTCCCCTGATCATCGTCACAGTGGGACACCACCAAGTGAAGAGTCTCGTGCTCCGCCGCCGCA
GTGATCGATCGGATACAACCTACGAGAGAATAGGTCTGGCGGTATTAGCCTACATCAAGGGCAAATCATATCTTAGCAAG
CGTGGGGTGGATTCCCATAACTATCATGTTCGATCTTCCTTTCAGGACAATGACATACTGTGGACAAACGAATACTTGTC
TAGCTTGCCCGCTGTCGAGATCACCATTACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62