GenePrediction:GLEAN_6150 Details

Name: GLEAN_6150
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1944275..1941905 (- strand)
Length: 2371
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1944275..1944207 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_144:1944081..1944053 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_144:1943775..1943598 (- strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_144:1943461..1943047 (- strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_144:1942975..1942665 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_144:1942576..1941983 (- strand)
Length: 594
Type: CDS
Source: GLEAN
Position: GCSC_144:1941928..1941905 (- strand)
Length: 24
>GLEAN_6150 class=GenePrediction position=GCSC_144:1944275..1941905 (- strand)
ATGATGGCAGCACCTGCTTTAGCGCAGCCGGGTCTCATGCCATTCCGTCTCCACTCCGTCGTCTCGGCCGTATGATCCCT
TTTGGCCCCAAGCTCTGTCGCTGGAGAGCTGTCAGCAGCGGCTGTCACCTTTCCAGGTCCGGTGCAGTCCTCTGAATCTT
TTCCGTGACATCTTGGCCATGGCCAATTTCATAGCTGCCTAGCGACGAAGAAGGAGAAGACGCGTATGTCGTGCGAAGTT
GTTTTTGCTGCCTGTCGAGTTGTTTGGGGAAGCTGTCTGTGCATAGCATGCGGTATAGTTCAAGGAACTTGACGATGTAC
TTTCTGACCGGGTCCAAGCTTGGCATATTGCTAGTCTTTGGTCGCTTCGAAACTTGCTCGTCGTTTGGTTCTTGACTCTT
TTTATTCTCTCCTCGCCGTTCTCTTCCTCCTCCTTATCCGTTCGTTCTTTTCTTGGTTATCACCATTTCTCTGCATCGTC
CCCCGTACTGCCCCTCCAAGATGTTCTTCGAAAAAAAATCCGGCGCCGGCTCGGACTCCGCCCGACGCGGTCACTTCGAT
CGTTGACGGCGCGACCGACTCCGAGATGTATCAGGCCGATGTGCCCGCGGTGGTCCAAGAGGAGGGCCTAAACGACCGGC
CAGTCGTGGATGTGCAGGCATACGTATCCAAGCCCATTGTGCGTCTCTGTCTTTCCCGTATTCGTCTGCCACTTTGTTGC
AACTCTGACAGGCTAGTGGATCATCATCGTCACCACCATGATGGCGTCCACCTTTCTCTTCTCGCTCGACAACAGCATCG
TGGCTGAGATCTAGCTGGCGATCGTCGAGAGCCTCGGCAGCTTCGAGAAGCTCGGCTGGCTGGGCGTGGCCTTTGTGCTG
GGCTCGCTCGCCACCATCATCGTCTGGGGCAAGATCATGGGCATCTTCAGCGTCAAGTGGTCCTACGTCCTGGCCACGCT
CATCTTCGAGGTTGGCAGTGCCGTGTGCGGTGCCGCGCCGACAATGAACGCCATGATCGGAGGCCGTGTGCTCGCCGGCG
TTGGCGGTGCTGGCATGTATGTTGGCTGCCTGTCGTTGCTATCGCTGACGACGTCGCTGCGGGAGCGCCCCATCTATATG
GCCTCGACCGGCTTCACCTGGGGCGCCGGCACGGTGCGGGGCCCAATTGTCGGCGGCGCCTTTGCCGAGAATGTGCACAC
GACGTGGCGCTGGTCGTTCTACATCAACCGTGAATGCTTCAGTCTGCTTGTCTGCTTGTCTGCTGTCCACTATAGCCCTA
GCTTACTTGACATCAAACAGTCTGCATCGGCGGCCTCTTTGCACCGGCCTTCCTCCTCCTCCTCCCCAACAGTGACCTCC
AGCGGGGTGTTCCGCTGGCTTCTCGAATTCGCCACGTCGATTACGTCGGCACCGTCCTCAACGTCGGCTTCCTCACGCCT
TTCATCATGGTCATCAACTTTGGCGGCACCGTCTACGCCTGGAGCAGCGGCCAGGAAATTGCCCTCTGGGTCATTTCCGG
CGTCGTCTTCCTCGCCTTCTGCGCGCAGCAGAAGCTGGCCCTCTTCACGACCAAGGAAGATCGCCTCTTCCCCTTGCGAC
TTCCTGCACATGTACGACATGTACCTGCTCTTCATCTGCATGGCCTCCGCCGCCACCTGCGTCTTTGTCCCGACCTACTT
CATCCCGCTCTTCTTCCAGTTTGTCCGCGGTGATGGAGCTCTGGATGCCGGCGTCCGACTGCTGCCCTTCATCTGCGTCA
TGGTCTTCTGCGGCCTGCTCAGCGGCGCCTTCATGACCAAGTCTGGCTACTACATGCTCTGGTTCCTGCTTGGCGGCTGC
CTTATTTTGACTGGTGGCGCGCTTTTGTACACAGTCAACCGCTCGACCTCGTCCTCGCGCGTCTACGGCTACATGGCCAT
CACGGGTTCCGGTGCTGGCCTCTACATCCAGGCGTCCTATGCCGTGGCCCAGGCCATGGTGGCCGCTAATCGCGTGGCCG
ACGCAGCCGGCTTTATATCATTTGCCCAGTACCTCGGCATCGCCCTCTCGCTGGCCGTTTCCGGCACCATCTTCCAGAAC
GTGGCCTTGGCCAATCTGACGTCCCTCTTCCCCGACCAGCCGTCGAGTGCGATTCGTGATCTGATTGCCGGCACAAGCAG
CTCGTTGCTGGACGCCTTGGATGCCGTCCAGTCGGCAAAGGTGCTGCAGGTTATTATTGATGCTATGAGCCGGACGTATA
TATTGGTCGTGACCGCCGGCGCCGTGACAGTAGTGTGTTCGTGTGCGATGAAGGTGAGTCTTGTCGACGTGCTATTTGTA
GGGCTGCAAGATTACTGACAACGCCAGCGCGAGCGTCTCTTCCGGGGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62