GenePrediction:GLEAN_6151 Details

Name: GLEAN_6151
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1940607..1939525 (- strand)
Length: 1083
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1940607..1940392 (- strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_144:1940334..1940181 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_144:1940114..1939525 (- strand)
Length: 590
>GLEAN_6151 class=GenePrediction position=GCSC_144:1940607..1939525 (- strand)
ATGTCGTCATCTGAGCAACTCGGCTGGATTGGCCTAGGGTCCATGGGCATTGGCATGTCCATGAACCTGCAGAAGCATCT
CTCCTCTACGGGTGCACCAAGCTTGATCTACACCAACCGGACACTGTCTCGGGGGAAGGATCTGCAGGCTCTCGGTGCCA
TTCCCGTCGAGACGGTCGCTGAGGTGACCACTAAGTCGAGCATTATCTTCTCTTGTGTACGTGTTTCATGTCTTTCAGCC
ATAATACCGAACCATGTTCTCATCCCTGTCTAGGTAAGCAACGACCAGGTGCTTAACGAGGTCGCCGACGCGATCATTGC
AGTTGGAGTCAAGGGAAAGATCTACATCGATTGCTCGACGGTCCACCCGGACACTTCAGTCGCTGTCTCGAAGAAGATCA
CCGAAGCCGGTGGCCTGTTTGTTGCCTGTAAGTCATTGGCAAAAGCCATCTGAGTATCGTTTTCAGTAGTTCAACTCCCT
GACAAAGACACAGCACCTGTCTTTGGAGCCGCTCCTATGGCTGCAGCCGGAAAGCTCATCTTTGTCGTTGCCGGCCCAGC
CGAGGCAACCAAGAAGACCAGTCCGTACATCAAGGACATTATGGGCCGCTCCGTCATCGACATGGGCGAGGATGTCTCCA
AGTCCAGCATGCTCAAGATCGCGGGCAACATCTGCGTGGTGTCCTTCATGGAGGTCCTGTCCGAAGCCCACGTCTTTGCC
GAGAAGGTCGGCCTCGGCAGCGCCATCTTCGAGACCATGGTCGCCGACATGTTTGGCCCCGTGCTCGAGAGCTACTCCAA
GCGGCTCACGACCGGCATCTATGCGCCGGAGCCAGGCGGAAAGGCCGGCTTCGACGTCGAGCTGTCCATGAAGGATGCGC
GCCACGCCCTCAATTGCGCCAAGACGGCCGGCACCAGGCTCGAGGTCAGCGAGGTCGCCCTCAAGCATATGGAGCAGGCC
CGGGCACTACTCCCGGATCGGGCACTGGACAGCAGCTCCATGTACGGCACGATTAGGAAAGAGGCTGGCCTGGACTTCTA
CACAGATCTGTGCAAGGAGAGAGACAGCAAGGTATCAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62