GenePrediction:GLEAN_6152 Details

Name: GLEAN_6152
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1938743..1937794 (- strand)
Length: 950
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1938743..1938469 (- strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_144:1938370..1937794 (- strand)
Length: 577
>GLEAN_6152 class=GenePrediction position=GCSC_144:1938743..1937794 (- strand)
ATGGCTAATCGTCAATACTTTTACTTCTATGCACCGACATGGGACTTCCCTCCGGACGGTCCCATCAAGCTGGGCAACGT
TATCACGTCAGTAAAGCGACCTGAACGCGCTATGTACCGTGCTCCCCCACCAGATGATTCCGACGTATTCTCGACACAAA
AAAAAGACGTTGTATATACCGAAGAAAAGCTGAAGGGCGGAAAATTCTCTGTCTTGACCAAGTTCTTAAGTATCTTGGGC
TTTGGTGTCAATGCCAGCGCCGAAGTTGACGCGAGGTAGGCAAGCCCTTTGTCTCTCAGGCACTGCACGCAATATCGCAT
TTTGGAATTTGTTTGGGTTGAAGACGGCATGAATGCCTCGCTAAGAATTATAGTACCATGGCAACATTCTCCTTCAAGAC
CATCGAAACCACACAATTTATCCCAACACCGGCATATCTCCAAAAATGCGTCGAAAACGAAAATGCTCGCCGCTTCCTAC
AGATGTCCAGATACCGCAAGCCTCTCTACATAATCACCGGACGTAAAGTCGTCACTGGTGCCCAAGCCAATACTCTCAAG
TCTCGCACCGTCGGGGCCATTCTCGCTGCCGAAGTGGACAGCACGGTAGCCAGCGGCAGCACTATATCGATAGGTGGTGG
CCCAGGAATCGAGGGCAGGATGGAAAATAAGACCAGCATGAAATGGACGGGAGGCAGTGACTTTGTGTTTGCGTTTCGCG
TGAGCAAGGTGTTCGTCCACAAGGCTACAGAGCAGGTGGCAAGCGAGGACGAGTATCATAAGGGCGCTATGCTCGGTATC
GAGGAAGAGGCCGAGGTCAGCGGTCCTGAGTTGCGTATCTTAAAGGTCGAGGACCCAGATGCAGAAACTGAAAGATTTGA
CGCGGAGGATTTGAAAGAGGATGAAGACACGGTACTTTGTGCGATATTGCGTAGAACTGATGATGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62