GenePrediction:GLEAN_615 Details

Name: GLEAN_615
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:980058..984391 (+ strand)
Length: 4334
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:980058..980080 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_97:980446..980554 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_97:980618..984391 (+ strand)
Length: 3774
>GLEAN_615 class=GenePrediction position=GCSC_97:980058..984391 (+ strand)
ATGGAGGTGGTCCTCTTGACAGCGTAAGAGACGCCACGAGCCATCCCAAGCTTTCACGATGTAAGTTATCTTTCCACTTC
GTTCCAAGACTTTGCTCTTGACGGCTGCTGACTCCTCACAGGTGTACGTGCAGGTTTCTATTTCCATCTTAGACATCGAA
ATCCAAGGCTAACAGGTGCCCCAAAGCGAAGATTGATAAACTCGGAGTGCGGGGGTGAGCACAGCATCAAACTCAATATG
ATTCTGGCGACGGCCGACTAACGATCAGATAGCATTCGCTCCTTCAGCCCAGCGGTCCAGGAGTCTATGCAGTTCAATAC
TCCACTGACACTGATCGTGGGGTACAATGGTTCTGGAAAAACTGTGCGTCTCTACCGTTTCACGACAGCCTGAAAGATCA
GCTAATAAGCCAGACCATTATCGAAACGCTCAAATATGCGACTACCGGCGAGCAACCACCCAACAGCAAGGGCGGTGCCT
TTATCCACGACCCGAAGGTGAGCCTGTCATTGATCCAATATCGATTCCTAGATTACGGTTGAGGCTGACACTAGCTGCAG
CTATGCGGAGAGAAAGAGGTCCTCGCGCAAGTCAAGCTGTCGTTCCGGTCGACGGTGGGCCAGAAACTTGTCGTCACCCG
AAGCCTGCAGCTCACGATGAAAAAAACGCAACGGTCAATGAAGACGCTTGACGGGTCGCTCGTGATCTACAACAACGGCG
AGCGCACTGGCCTGTCTACCAAGGTTGGCGAACTGGACGATCTCGTGCCCAACTATCTCGGCGTCTCGCCGGCCATCCTC
GACGCCGTCATCTTCTGCCACCAGGACGAGTCGCTGTGGCCGATGAGCGAGCCAGCTGCGCTAAAGAAGAAATTTGACGA
GATCTTTGAGGCTATGAAGTACACCAAAGCCATTGACAACCTCAAGGTTGTGCGCAAGAAGCAGGGCGAAGAGCTGCAGA
AGCTGAAGATCCTCGAGTCTAGCAGCAAGGACGCAAAAGAAAAGGGCCAGCGGGCGGAAAAGCACCTTGCCGGCCTGCAG
ACTCAAATTGAGGATCTGCGAGAGCAGGGAGAGGACCTGACGCGGCAGATGGACGAAGTGCAGGGCCTGGCCAAGAGCCG
ACGCGAAGAGGCAAACTCGTTCTTCGGCATAGTGCAGGAGCTGAAGAGCAAGCAAGACCAGTACGAGGTCAGGAACGAAA
CCGTCACGGAGCTGAAGGACAGCATCGTCAAGATGCGGACTGAATCGGACGAGTGGCTGGAAGAGCACCTGCAGCAGTAC
GAGGGCAGCCTCGCGCGGCTGCAGTCGGAGAAGGAAGCGAAGACGGCCGAGCACCGCAAGCTGCAATCCGAGCTCAGCAC
GGCTCGCAGCACACTGGGTGCGAAACAGGCGGAGCAGGGCAAACACCAGTCGGACAAGGAGAAGTACGAGCGGCAGCTAC
AGACGCGCGTGCAGATGGTGCGCGAGGCGGCGGAGCGACACGAGGTCCGGGGCTACGAGAGCGAGGACCTCAAGGACAGC
CAGGTGCAGACGTTCCTGGACCGCATACAGAAGGTGTGGCAGGACAAGCGGCGGGACCTGGAGCGACTGCAGCGAGACAA
TGCCAAGGAGCTCGAGAAGGACACGGCAGTGATCACGGAGCTGGAGACGCGCAAGGCAGCACGGACACAGGACCGGGTGT
CGGCGAAGCAGCGGATTGCGGCGATCGACAGGCGGATGGCGGCGCTGCAGAGAGACATGCAAAATGTGGACGTGGATGAG
GGCGCGCAGGCGATCCTGCAGTCAACGTATGCAGACGTGGAGACGCGTCTGCGCAAGACGGCAGACGAGATCCAAGCGGC
AGCGGCGGACGTCAAGATCGAGGAGGAGAACGGACGGATCTGGCAGCTGGAGAGAGAGAACGAAAAGCTGACACGCGAGC
TGGTGGACTGCACTCGACGCGCGTCGGACCGGGCACAACTGGACCTGCGCAAGAAGGAGCTGACGGAGCGGAAGCGACGG
CTCGACACGCTGACATCGACGTGGCAGGAGAAGCTGGCAGCAGTGATCGGGCAGCAGTGGACGGCGGAGAGCGCCGAGGC
AGACTACCAGCAGGTGATGAAGCAGCACGTGACGACAGTGGGAGCAGCGAGGAAGAAGGTGGAGACGAGTCAGCAGGAGC
TGAAGCAGGTGGAATACCGGCTGTCGATGATGCGGGAACGACAGAAGAAGACGACGGCAGAGGCAGAGCGATGTCAGAAA
GCGGTAGTGTCGGTGCTGAAGGCGGTCAAAGCAAGCGGGAGCGGCGAGGACGGGGCGGTCTCGAGCGAGGCAGCATCGAT
CGACGACTACCAGGAGGAGCTGGACAACACGGAGTCGGAGATTCTGACAGCAGAGAAAGATATCAGCCTGTTCGACCACC
TCAAAGACTACTATTCCAAGTCGCAAAAGGTGCTGAACCGGTTTAACAAGTGCTCACTGTGCGACCGATCGTTTGCGGAG
CAGCCACGGGAGCGGTCGAAGTTGCTCGAGAAGATTGCCAAGAACCTGGACGACAAGCAGAAGAAGGAGCTGGAGGAGGA
GAAGGACATGCTGGAGCAGAGCCTGGGACAACTGAGGGCGGTGCGGCAGCAGCATGACACGTACCGACGGCTAGAGTCGG
AGCAACCAGGGCTGCGGGCGGAGACGGAGGCTGCAGAAAGTCAACGGGACACGCTGGTGCGACGGCTGGAAGATGAGGAC
GCAGTGCTGCGGGAAGCGGAAGAGCGCCGAGCGGAGGTGGAGTCGATGGGCAAGACGATCGGAAGCATAGCACAGGCGGT
GCGGGAAGTGACGGAATCGGAGCGACAGATCGAGAAGCTCACCAGCCAGCAGCAGGCGTCAGGCTCGGGCTCTGGGTCGT
CATCGAGCGTGGAGGAGATTCAGGAGCTACAGGCACGCTGTGGCGAACAGCTGCGAGCAGCACAGACGCGGCTGGCGAAG
CTGTCGGACGAGCGACAGCGACAACGAGACGTGATCAGCGGGCTAGAGCTGGAGCGGAGCGAGCTGAAGAACCGGATCGC
AGAAGCGGCACGACAGGCGGAACGGAAGGCAGATCTGGGACGACAAGTGCAGACGCTGCGCGAGGAGACAGCACAACAAC
GCGAGGCGATGCAGCAGGCAGATGTGGAACTGGAGGGTCTGGTGCCGGAGATGGCCAAGGCACGGACGATGCGACAAGAC
ACGCTGCAGCGAGGGCAGACAAAAGAGCGGCAGGGAGCAGCAGAGCGAGACGCGGTAGCACACACAGTCAGCGAGCTGCG
GATGTTGGAGAAGGAGATGCAGGACTACGTGGAAGGTGGAGGAGCGGAGCGGCTGGCAGCCAACGGACGAGCAATGGCAG
CACTGGAGCAGACGATGCGGGAGACGGAGCAAGCGGTGGAGACAGTAGCAGCAACAGTGAGCCGGATGAGCACGGAGATG
GATAACAGCGACCGGGAGAAGAAGAACATTGCAGACAACCTGAGCTACCGACGCAACTCACGGCTGCTAGGCGAGCTGCG
AGGACAGATCCTGGCGCTGGAGGAACGACGGGCAGCCGACGACTACGACCGGCTGGTAGGCGAGGCACGACGGCTGGAAG
TGCAGCACAGCAAGCTGCTGGCAGAGCGAAGTGCGATCTGGGGCAGCATGAAGACCAAGGACGAGGAGCTGCTGCGACAA
TTGGACGAATACGAGCAGGAGTACCGGGACGCGGAGCTGCGGTACCGGGAGGCGCATATTCGGGTGGAGACGACCAAGGC
TGCGATTGAGGATCTCGGGCGATATGCAGCAGCGCTAGACAAGGCGATTATGGAGTACCACGCGTTCAAGATGGAGGAGG
TCAACCGGATTGCGGGCGAGTTGTGGAGGGCGACGTATCAGGGAACAGACATTGACACGATTCTGATCCGGTCGGACAAC
GAGGCGGCGACAGGACGGCGCAGCTACAACTACCGGGTCTGCATGGTCAAGCAGGACACGGAGATGGACATGCGTGGACG
CTGTTCGGCCGGTCAGAAGGTGTTGGCCAGCATTGTGATCCGGCTGGCGCTGGCCGAGTCGTTTGGCGTCAGCTGCGGGC
TGATTGCGCTGGACGAGCCGACGACGAACCTGGACAGCGACAACATCCGGTCGCTGGCAGTGTCGCTGCACGCCATCATC
CGGGCGCGGCAGGCGCAGGCCAACTTCCAGCTGATCGTCATCACGCATGACGAGGACTTTCTGCGGCATATGCAATGCTC
GGATTTCTGCGATACCTTTTACCGGGTCTCGCGGGACGACAAGCAGAACAGCGTGATCAAGAGGGAGAGCATAACGCGGT
TGATTGAGGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62