GenePrediction:GLEAN_616 Details

Name: GLEAN_616
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:986952..987310 (+ strand)
Length: 359
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:986952..987049 (+ strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_97:987106..987310 (+ strand)
Length: 205
>GLEAN_616 class=GenePrediction position=GCSC_97:986952..987310 (+ strand)
ATGTCCTTCTTTGGCATTGGCCGGCCGCAGCCGACGTCGGCCGAAAAGATCGCCGCCGTCGAGGCCGAGATGAAGATGAT
GGCCGACATGCACAACCGGTAGGTCTTCCGTTCTTTGTTCTCGGCCCTGGTCGGACTCCTGCTGATGACGACAGCCTCGT
CAAGAACTGCACTGCCAAGTGCGTCCCGGGCGAGTACCGCGAGGGCGAGCTCAACAAGGGCGAGAGCGTCTGCCTCGATC
GCTGCGCCGCCAAGTTCTTCTCCGTCCACATGACCATCTCGGAGCAGATGCAGAAAGAGGCCCAGCAGCGTGCTGGCGGT
GCCGCGCCTGGCGGTGCTGGCTTCGGCTTCGGCGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62