GenePrediction:GLEAN_617 Details

Name: GLEAN_617
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:991374..992833 (+ strand)
Length: 1460
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:991374..991506 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_97:991559..991692 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_97:991781..992833 (+ strand)
Length: 1053
>GLEAN_617 class=GenePrediction position=GCSC_97:991374..992833 (+ strand)
ATGGCCGACAAGATGCCCGCTTTGCGGGCAGAGCTCTCCCAAGTTGCACGGAAAGCTCGGCTCTCTTCTGCGGTAAATGA
TGTTGACAAGATCATTGCTCGGCTTTTGCAAGCAAGAGAGCAAATCGCTTCAGGTAGGACGCTTGGCAGTCCTCTAATAT
ATTATGTCCTAATTATTTCTTGCAGAGCAAGATCCCCACGCCGCCAGTCTTATCTTGACGAAGCTTCAGAACCCCATTAA
AGAGGGGTTCGAAACAGTCAACAATGACTTGAAAGCTGTGTCCAAGACACAGCGAGAGTTTGGAAAGGCCCTTGACCGAG
TACGTTCACCATATGGCCTGACACTGCAACATTACATATGCATTTCCTCCCCTATGCCGAGAGCTTGCTGGTTGCTAACG
CCTGCAGTCTTTCCCAGTAACCAACCTTCCGACCGACCACGATGTCATGGCAGAACACCCGGCTCTCATCAACCGAGCCA
TTGCGATGCATCTTCTGCGCGAAGGTCACTTCGACGTTGCAAGGATATTCATGGACGAGGCCCGAGACATGGCGTGCGTA
GCGACGACATCCCATGCTGACGATTATGCGGATACAGACATGGCGAACGCAAGCACAACCGGCGAAAGCGCCGACATAAC
TACGGCGTCGCGATCTTCCGTCTCCAATTTTACACAGATCGAGTCTCTCGAACTTCAGGATAAATTTCAAAGCATGTACA
CCATCCTACAGGCGATCAAGGCGCACAACCTCGGCCCGGCCATACAGTGGGCTCAAACGAACTCGGAGGCGCTGGAATCA
CGTGGCTCAAATTTAGAGTTCGAGCTGTGCAAGTTGCAGTTCATCTGGCTAGCCAAGACGTCTAAAGGCCAGACCGAGCT
CGATTCCAATCTGACCGCTGGCATCGCTGGCGATTTCAGGGCGGCCTTTCAGTACGCCCGCGACAATTTTGGCCGCTTTC
AAGATCGGCATCTGCGTGAGATCCAGCGCTTGGCAGCGGCCTTGGTGTTCGCTTCCAACATCCAGGAATCGCCGTATGCC
AACGTCTTTGAGACCACGTTTGCTTTTGACGAGGTCGCTGTCACATTTACACGTGAATTCTGTTCCCTGCTAGGCCTGTC
GGCAGAATCACCGTTATACGTTGCCGCAACGGCCGGAACGATTGCGCTTCCGCGACTTATCAAATTTATTGGCGCCACCC
GAAGCAAACGTACCGAGTGGACAACGGCCAACGAGCTGGCCTTTGAAACACCGCTACCAGAATCGATGCTCTACCACTCT
ATATTCGTCTGCCCTGTATCAAAGGAGCAGACCACCGAAAACAATCCGCCGATGCGACTTCCTTGTGGTCACGTCTTGGC
ACACGACTCGCTTCGGAATCTGGCTAAGGGCTCCAAATTCAAGTGCCCATATTGCCCTATGGAGGGTCATCTCAAGGATG
CACGCCAGATTGTTCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62