GenePrediction:GLEAN_6181 Details

Name: GLEAN_6181
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1765501..1763818 (- strand)
Length: 1684
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1765501..1765203 (- strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_144:1765138..1765075 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_144:1765017..1763818 (- strand)
Length: 1200
>GLEAN_6181 class=GenePrediction position=GCSC_144:1765501..1763818 (- strand)
ATGCGCATGCGCACCACCTTCTTTCCTCGGCCACAGCGCCCCGTGGACCCGGCATTGCTGCACCTGAGGGGCCCATCACT
GGCGGGTCCGACCGTCGAGGCTTCGCGTGAGGATCGCGCCACGTTGTCGCTGGACCAATTGCCGGCAGAGTTAGCTCACA
TCCTCGGTGACGGCGTTCACGAGTTGCACATTCGCTGGGCCAGTCCACAGCCCTTTGAGGCCGTCAGCCCGCTGTATGCC
CGTCTAGCGCCCGGCCTCCACGTTTTTTACACCCCCCAGACGGCTACGGAACAGAGCCGGTAGGAACACAGCCGGACAGC
CGCAGCTCCATCCTGACGTCTTCGATGCTAATCTTCTCCCAAGGGATGCTATCTGCCTTCTTCTGCACAAGGTCTTTGGC
CCAAGCCTCGACTGCAGATCTCTCAGCGTAAGCTTCCCGGCCCGCACGTACCTGTGTATCAATGCTTACCCTGCTGGTCT
TTAGAATTCCTTCACTGTCCTCGGAGGTGGTCGCTTCTCTCATTCTGCTGGTTACCAGTATTACTCAGATCTAGAGGATC
TCTCTGGTCTTGCCGACTATGTCCAGACCAAGTGGTGCCCTGGCGAGGATGGAACCCCTTGTCCCTTCAACGTGGACCTG
CTGCTCGGCGCCAGCTCGGTGGACCTATCTTACGATGCCATTTCGCACGCGTTGAAGGTGACTACATTTTGGCCGTTGGC
CGCACGAACTATCGAGGGAACGGCCCAGCCGGGCTCTCGTACGGAGCTGGGAGTCTTGTCAGGTGAAATGCCTGCAAACT
TGGAGCCGTTTGAACTTGGCATGGCTGGCCATGTGGCAGTTCTAGGCGAGGATACCCATCCATCTCCGGTTGTGTTCTCC
TTTCCCTCGCGGCACCGAAATGCCGAAGGGGCCTCCTTTTCGTCCGGCTTTCTGCGGCCTGCTGGCCTGCACCCGGCGCT
GCAACTTCGCATCGCCTCCGGTCCACCACCACGGGTAGATAGCTCAGACGACGGGTTTGCGTCATCTTCATGCAAACTGC
ATGCCTATTTGACTCTACCTCGACATATCTTTGCCGACAAATACCAGCTCAGCGATCCTCTGTTCCTTGCGTCAAAAAAT
CTGACAGCCTTGCGCCACACCACACAGCCAGTCGACCTAGAGGCCCCCGATTATGCCGTCAGCAGCTGGGGTTCGGCAAT
CCTGTTGGAGCTTAAACCGCCTGCAGAGCAACAGACCCAAACTTGGACTGCCGAGGTCCCTCTGCATCTTCGCTATCTCC
AGCCGGCGGCCGGCGGCTACAGCATCGCCGAGCTTCCGTACCCGGTTGTGTTCTGGGCCTGTGCAGCCGAAGACGGCACC
AAATTCTCGACCAACCCGTTTGACCGCGTGAACCTTGGCTACGACGGGCTCTTCGGACCACGGACAGAGTTTTGGCATGT
AACGCCCAACCCGCCTCCGGCGTCTGATAAGGCGGTATTGTCCTCGTCAAACAGCTTGAAGATGGCAATTCGCGTGCCTG
TACTCGATTCTAGTAGGATGGACAAGGTCAATGTCGGCACTGCGGCTGTCGTGCTTCTTGGATTCACCTGGGTGTTATGG
AAGTTGCTGGCAGTCTATCGCAAAGCGGGACATGGCCGGCTGCCAAAGCCAGAGACAGATGCAGTCGAGAAGAAGACGCA
ATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62