GenePrediction:GLEAN_6188 Details

Name: GLEAN_6188
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1734043..1726078 (- strand)
Length: 7966
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1734043..1733219 (- strand)
Length: 825
Type: CDS
Source: GLEAN
Position: GCSC_144:1733160..1732537 (- strand)
Length: 624
Type: CDS
Source: GLEAN
Position: GCSC_144:1732016..1731886 (- strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_144:1731794..1726289 (- strand)
Length: 5506
Type: CDS
Source: GLEAN
Position: GCSC_144:1726104..1726078 (- strand)
Length: 27
>GLEAN_6188 class=GenePrediction position=GCSC_144:1734043..1726078 (- strand)
ATGGAAGACCAGAATTCTGTATTCGTTCGACTGTATCCTTATGAGGACAGCAAGGGATTTGCCCTGGAGGCAATCAAAGC
TTGTTCACGATACCAGCCGTCAAAGGTAGTACCGCGAGAACGCCAAATCTACATACAGGATGACAGAGACGACACACCGC
CACCAGAAGATGAGGCGAGCCTCGACGAGTTGCCATACATAGAGCTCCGCTTCCACGATGTCCCTTGCGCCCCGGGAGGG
CTCATCTTTGGAACCGAGCCGGGCCCAGATGGAGTTGTGCTCCCAGGTCTACCTGGCGTTGACGAGCACCATTTTGCTCT
GACGTTTGCGAATTCGTTCGAGGACAGACATCACCGCCTCATCGTACGCGACCTAGACTCCGAGACCGGCACCTGTGTCA
CATATGACGAGCAGGGAGGGGAGCCGCGTAGGGCATTTGCCTGGACCATGAACGGCTTCGACCTGCCTGACCATGCCAAG
TGCATTGTTGTGCGGCTGCATCGATACCTCAACTTCCAGGTTGTCGTCACACGCCACGACATTGCCTCGGCGGATTACCA
AGCCAATGCCGAGCGTTTCCGCCGAGGATGCACGGCCCCCGGTAGAAATGACACTCACCTCGCCGATCAGAGCGAAAGCC
ACCCCGTCGTTGATCGTCCTATGGTCCTTAACATGGGATGGCTGGCACAGGGTGCCTTTGGGGCCGTGAGCCGTCACTGG
GATGTCAGCACGGGCGAGGAATACGCCTGCAAACGACCTCTAGGACGCGGATACGATCAAAGAGCCTGGGAAAAGGAGAT
CAACAATCTCCGGACCATCTCACACGTCAGTACATATCAACCCTTCCATTTGCTACCCAGACTGTATACTGATGGAGTCC
TAGGCTCACATCGTGCGGCTGTGTTTTGCGCGAACAGAGCCGACCCCAGCCATATTTCTGGAATATCTGAAGTTTGGAAA
CCTCGCTGACCAGCATCAAAAGACGCCGTTCTCGCACGGCGAGTGTCTGGTCGTACTGCAGCAAAGCCTGTCTGCTTTGT
CGTATCTCCACCAGCGGGCACTACCCATGGCACATCGCGATATCAAACCGGAGAACATTCTGGTCAAACACCGCAATCAC
AACGGCGACCCCAGCTACCTCTATGTCAAACTATCCGATTTCGGCCTTTCCAAGGACAGCACGCTCAAGACATACTGCGG
TACACGAGCCTACCTTCCGCCAGAAGTGCGCAGAGATGCAGAAACTTACACCAAGGCCGTTGACGTCTGGTCACTGGGGG
TCGTTCTGTTGCGCTTCGCATACGGCCTTCCGCAGTCGGGCACCGGTGAAGGACTGGAGTGGTGCAAAGCTATCGTCAGA
GAGGTGAACCGCCTCGAGCCTGGAGGCTTGGCCGGGATCCTGCAGCACATGTTGGTCATGGAGCCGCAGACACGCTTCTC
GGCCACTGCCTGTCTCGAAGAGGTGTCAATGCTCCTCTTATCGCCCCAAGGATCAGCAGCTTCTCCGGTACCTAGTGCAA
ACAGCGTGATAGGACAGGTTGAAGCCTATACCACGCAGAGTCTAATATCCGTTGGAGGACACTAAAGGACTGCTTGATTA
GCTGGAGGAGTCGTGTAAATAGTAGATTGGTTGGCGTGTGTCATTTGAGAAGAGCGATTGATATTTCAGAGCTTGGGACC
TGGCATGGCTATACGTTTTGTTTGCTAGATTCGACATCCAGTGTATCTGTGTCTTCCCCTACCCCCAATAAAGCAAACGG
AAACGGTCGTGTGTGATGCCAAGAGGCCTGTAATGGTATACTGGAACTTAAGCGTTGCTGTGCTGCTATAGGCGGAGCCG
AGCTGGAGACCCCACAAAAAACACGGCCACCGCTAAAACGCCAAAGCTCTTGCCGCGTCTTTTTGGCGGTTCGCCAATCT
TTTTTTGCGACTTCACCAGAGGACTGAAAAATAACAAAGCAAGCATCGCCAAGCATCGCCCACCTGGCTGTCTGCCCCGA
ACAGCGGCACTTCCACCGTCTCTGCAGCATCTGAAGTTTCTGTCTCTTGCAGATGCCGGCATTGACGCCGCAATACGACA
CATGACGATGGCACCACCATTGGATCACATCTACTTTCCGCCCCTGGAAGAGCTCTTGGAAGGAGAGACAGTGCTGCTGT
ACGTGCCCTCTGCCTGCTCCGCTCTTTCTCCCGGGGTGCTTGGAAGCCCCCGCATCGGGGGTGCTGCCTGCTAACAAGAG
CGTGTACAGATCATGGAAGCTGGTGGCATCAGCGCTTTCTGATGCGTCGAGCGACCGGCTGACGACCGATGCGGTGACGG
AGCTGCTGACGGAACCGTTTGTGCTGGAGCTGCTCAAGTGGCCCGGAAAGGCGTTTGAGAAGCCGACGGCCCAGACGGCA
GCGGCACTCGAGACGAAGACGGCGGCGATTAACGTGACGCCAACGCCCAACGAAAAATACGACATCAAGGCGATCAAGGC
GGACGCACTCTGGTTGAGCAGGGCAGCAAGCATCAACGAGGTGACGGCGCTGCGGATGGTGGTGACGGAGCTGCAGGCGC
GGTCAGAGGAGTTCCTGGCAGCTCCTCTGTCATCACAGGACGTCACGAACATACAAAAGGCAGCGGCGGGCGGCGTGACG
TCGGTACTGCAAGCAACGCTCGATGCTGAGGACCTGTGGACGGAGTTCAACAGGCAGGACAGCCGGCGACGACGTCTCCT
GGCGACGTATCTATCGGAGCGGCGGTACTTTGCAATGTCGGCAGACTACATCACATCGCTCATCATGCACGGGGCGACGA
CGACGACGACAATAACAGCAGCGGTGGAGGATCTCCGGAGCGCGTTGGCACAAGGTTTGCTCGGCACAGGCAAGGAGGCG
GAGCCGGATGCGCGGGCGATGGTCGCACAGCTGCCTGCATATATCGAGGAGCTGCGCAGCTGCATGCAGCGGGCAGAAGA
GGGCATCGAGGGGACCGTGAAGCAGGCGGAGGAGATCCTGACAGAGGAACTAGCGCTGGAGTGGGTGCAGACGGCGCTGA
CGGAGGCTGTGCACTACATGTCGGTGATCTTTATGGGACTGCAGAGCTCGCGAGAGCTGTTCCTGCCAGCATCGCTGGCG
GCCGACTGGTTCCAGTTTGTGGGCGACTACGGATTCCTGGACGGGCTGACAGGCGGCGACAAGGCGATGTCAGAGCTCAT
TCTGCCATTGAAGACGCTGGCGTGTGTTAACTCGCTGGTGGTGCTGAACGTGAACCGGGCGATCGGATACCTGGACCACG
ACGTGGATCTGGACGGCGAGGAGGAGCCGTACGTGAACAGCGCGGAGGTGCTGGAGGTGATGCACGCGGCGATTGTGGGT
GCGGCAGACTCGGGGCTGGCGACAGCGAGCCCGGTGTTTCTGTCGTGGTCACTGATCCTGCACCGGATGGACGTGTCGTA
CCAGGAGCGAGCGGAGCGGCGAGACCTGACGCAGAACCAGCGGGCACAGGACAGCTTCGAGCTAGACAAGCAGGTGCCGT
CATTTGCGGCGCAAGCGCTGCAGCCGCGAGGACGCCGGAGCTCGGTGGGCAGCATCGTATCGATCGAGGCGGCACGGTAC
GACGGGTTTCTGAGCGAATTTGTGCTGGGGTCAGCCTCGGAGCCGGGCGAGGCGATGGTGCCACGACTGGCAATGACGGC
GACAGAGCAGTGCCAGGTATACGAGGTGATGAGTGCGATGGCAGGCAGCGCGGGTGTAGGAGTGGAGGCGGCTTTCCGGG
GCGTGCTGGGAGCGCAGATGCGGGTGGTATTCCTGGAAGTGCTGAAGGCGAGCTTCCCGATCGTGGGATACCAGTCGGAA
CCGGTGAGCGCGCTGGTGGCGGTGCTGTCAGGCGGCGCGGAGGCATGGGAACGGACGGAGAGACGACAGACGAGGAGGGA
CGAGGACGAGATGGTGGCGTCGGCAGTGCTGCAGGACGGGCAGCTGTTGCAGTTCTACGTGCAGAACGCGCTGGGACGGT
TTCCATACGAGTTTGCACCGTTTGTGTCGATCAGCCGGCTGCTGTCGGCAGGCGATGGCCCGGACATCACGGACATTGTG
ATGGAGTATCTGCTGCAGACGCCCAGCCTGACATTCAGCCTGCCGAACAGCTTTACGGGCTACGCGATGATCGGCGAGGA
CGAACACGCGACGGCGACGATGCAGACGACAGAGGACATGTTGCTGTTCCCGACAGGGACGTCGCGGCGGCCAGGAACAG
CAACGACGATGGTGATCCCGGCCGGGACGTACGGGCGGTTCATGATCGACGGCAGCGGGATCGTCAACATGGACTACGGG
CACTCGACGATCGCGCTGCTGGGCAAGTGGCTGGACGCGAACGTGGCAGACCAGGTGGGCGAGCCGGTGCTGGGCGTGCT
GGAACCATGGGAGGCGGCAGAGGCGATCGGGCTGCTGGTCGGACTGGTGCGATCGGAAACGGGCAAGGCAGCACGGCAGA
CGACGACGCGACAGACAGACAACACGCGAGTGTCAGCAGCCGGACTGGCGGTGCTGCAGGAGGCGAGCCGAGACCTGGAC
GCAGCCAAGGACATTGTGACGGTGGTATGCGACACAGTGGACACGCTGATCCAAGACGGGCCGGCAGAAACGGACTCGGG
ACGGTTGGCAGTGCTGGCGGCGTGCATGGACTTCTTGGAGGCGATCCTGGAGCTGTGTCCAGGGCGGGTGTGGTCCTACA
TGGCGCGATGCCAGCTGCTGAACACGGAGTCGCGGGCAGGACGTCTGTGCATCCTGACGAGTGGATCGGACGTGGTGGCA
GAGCGGTTCAGCTTCTTGATGGCGGCACTACGGTTCCTATCAGGGCTGGTGGACGGGGCAGCGACGAGTGCGGTGCAGAG
GAAGATGGCCGGAGGGAGTGGAGGGAGTGGACGACACGTGCCGGACAGCAACATCTGGCTGGGAGCATCGGACAAGACGC
TGGGGCAGGTGTGTCTGGCGGTGGCGCAGACGGTGGTGGACTTGCACGAGAACACCAGCACGTGGAAGTTTGCGACGGAG
ATGCAGCGATCGAGCGTGGTGGCAGCAGCGGTGGGAATGCTGGGACGAATGGTGGTGTACGCGTCGAGTCTGGCGGAAGG
GGTGGACGGGCCAGAGAGTCGGCTGATGGGCAGTTTGGAGGCGGGAGCAGCGTTTGTGGTGAGCAGCTTTGGGTCGACGG
CGGCGTCGTCGTCGCTGCGCTTCCAGCCACTGTTGGCGACGCTGCTGGCAGGACTGGAGCAGTCGACGACGGCGACGCTC
TACAAGCGAAGACGAGAGGGAATGGAGGAGCGGACGGTGGCGGTGCTGAAGCTGGCAACGAGTCTGGTGGGCCACGGACA
AGGGACGAGTCTGGGGGGTGGCCTGCAGGCACAGATGTTCCAGATCGCATCGCTGCCGGCGCGTCTCTGTGGCTCAGCTT
CGGGGACGAGCAGATTGCGGCCGGCAGCCCTGGAGCTGCTGACGGAGCTGGTAGTCAGCGCGGCGACGCTGACGGCGACC
ACAGCCAGCGAGCCACCATCGCTGCTGGGCTACCTGGGGCCACACGTGTCGCGGGCGTTTCTGGCCGTGCTGGCACGCAT
GGACGGGCCGTTTGGCCGGGCAGCCGAGAGGGCACGCATATGGCGATTCTTCTCGACCGTGCTGCGACATCGGCAGCAGT
GGATGGCCAACTGTCTGCTGACGGGCAGGACGCCACGCGAAGCCTTGCGCGAGGGAGGAGAGAGAGGCGAGGCCGAAGGA
CCACGACTGCAGCTGTCGGCAGACTCGGTGCTGGCCAAGGCGAAGGGGGTGTTGAGGCGGATGGGAGCGAGACAGACACA
AACGAGCCCGAAGGGCGAGGAGAAAAAAGGCGAAGAGACAAAAGAGTTGCTGGCTGTTCTCGATTTCTTCTCAGCCGCCC
AAAACTATTGGCCATGGACGATCTTTGCCGTGCGCAACAGCGACGGCGACCATCTCGACGGAATGCGGGCATACGTGCGA
CAATTGGCACCAGCAGCAGTGACGGCAAGGACAGACGCCGAAGCAGCCTTTGGCCAAGCACGCATCGCGGCGTACGTGGC
AGAGATCTTTGCGATGCAGCTGTACCACATGCGACAGATGGGCACAGAACAGGCTCTGGCACGTGACGTGGTGCAGGACG
TGGACTACTACCTGCGCGAAGGCGTTGCCGTCGAGGGCTACAACACATCGCTGCACACCAACTTTCAGCGCAACTTTGCA
CAGCGCTACGGCGGGCTCTCGCTAGACCAGCTAAAGCGGTCGCTAGTGCAGCCACGCGATCTGGGCGGGCAGTTCTACTA
CGCGCTCGACCTGGCCGACTCGATGCTCAGCTTTGACGGGGGATGGGGGGGTGAGAAGGGACGAAACGGCAAGAATAGAG
GATTCCGGCTGGAGATGGAAATGGCCAATTGCAACCTCTCGCTGGTGGACGCGCAGATTGCACTGTACCACGCCTGGGAA
GTGCTGCTGCTAGAACTGAGCGTGTGTCTGTTGCCGAAGCAGAAGGACCAGCGGCTGCCAGTCGTGATGTTGCAGGTGGC
CGAGCAGTGTTTGACAGCCAATGGGAGTGGAGGAGGAGGAGGCGACATCTTTGGACGGCTAGCCCAAGGGCGGGCCAACC
TGGCACTACTACTACTACAACGACTGGCCGAACACGGACTGCTGCCAGCTGACGGATCGTCGCTGCTGCTGGCCGTGTGG
ACGAGCATCAGCAGCGTGGAAGCGCCATGGTCGATGGAGCAGGCGACCTACTATCGGACACTCTTGCGGATTCTATATGT
CGTCTTGCGCGGACAGAGGAGGGAGGGTGCCGATGACGGCAAGACGACGAACAGCGACGCCAACGACATCTCGACAACAC
AGACCGTGCTGACGATCCTGGACCGCGTCGTTGCGGCCGGTTTCCGCACGCTGGTCGGCCAGGTGCACGACGTCGAGGCC
GAGCCGCGACCTGACGACATGGCCCTGCTGACGGCCGTGCTGCAGGCCTGTCTCTGTGTGCCGGGCATCGGCCAGTGTCA
CGCCCAGGTGCTCAACATCATGGCCGCCCACGACGTCCTGCGCGCGGCCGAGTCGCTCTTTTCCTGGTCCGATCGGGTGG
GCGGTGGAGGTGATCCCGTCTACGGCGAGCTCAGCCTCTTGTTTCTGCTCGAGCTGTCGGCCCTGCCGGTCGTGGCCGAG
CAGCTGGCCTGTGACGGCTTTCTCGGCCATTTTGTCGCCGCCGGCCTGGCCACCCACATGCGTCGTCCCGGCGTCGAGCC
CATGGCCGATGTTCCGGCAGCGCAGCGCTGCTACGGCATCTGGGCCAAGGCCGTCCTGCCGCTGCTGCTCAACGTGTTGG
TGGCGCTGGGTGCCAGCATCGCGCCCGAGGTTGCCTACGTGCTGAACCAGTTCCCCAGCCTGCTGGAGGGGAGCGTGCAG
CGGTTCGAGGTGGGCGAGGAGAGGATGGGACAGAAAAGCACCGCCAGGGACAGCCTCACCCTTCTGGCCGTGTCCGAGAT
CCATTCGCTCGCCTTGCTGACACAGGTGCTCGCGGCCCTGCGGGTCAACCATGCGCGCGACATCCCGGCCGTCGGCTGGG
ATGCGGCGCCCGTGCGCGAGAGCGTCGACTTTTGGCTGGCACGGCCTAAATTGCTGCGCGAACGGCTGGTGCCGCTGGGC
GGACGCGAGTCTGAGTGGCGGACGCTGGAACCGGTGCAGGCTGGAGGGCCGGCGGAGAACCGGCTGGAGGAGAAGGTGTT
TTTGCTGTTGGAGGGAGTGAAGACGATATTGAGTGAGGACGAGGAAGAGGAGTAGGGGGGAATGAGAGGAGAGGAGATAT
GATGGAGGAAGAGAGCAAAAGAGGATATATGACGGAGAAAGAGGGTGAGAGCGGAAGAGGAGGAAACGGAGACGAGGAGA
CGGAGACGGAATGATCAAGCAATATACGATTAAGACGACAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62