GenePrediction:GLEAN_6189 Details

Name: GLEAN_6189
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1723553..1720449 (- strand)
Length: 3105
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1723553..1723160 (- strand)
Length: 394
Type: CDS
Source: GLEAN
Position: GCSC_144:1722972..1722817 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_144:1722760..1720449 (- strand)
Length: 2312
>GLEAN_6189 class=GenePrediction position=GCSC_144:1723553..1720449 (- strand)
ATGACCACAACCGCTCCCGCTCCCAGTCCGTCGCTGGCGTCGACCCAACCTCATCAACCTCATCTTCAGCCACAACCGCA
GCTGCAACCGCCTCCTCCGTCACATCAGCAGCAGCAGCCACAACTGCCGCAACAGCCACAACAACAATTACTACTTCGGC
AACAACATCACCACCTCCATCTCCCACCACCACCGCCATTTGCCGTAAGACCGCAGCCGGCCCCCGTGGCCTCGACCGGT
CCTCTTCAACCCCTCACTCCGAACGTACTCCACCCTCCAAAGGCCTTCGTCCCTCCAGCCGCCGTGCCCAACCCTACGTC
TCCACCGAACAAGCGTGATCTCAAATCTTGGTGGAAGGGCTTCATCCTTCAGTCCAAGAGTCATGATGTGCCGAGTAAGC
CCTGTCCTTCACCGTCCCTCTCTCTGCCTTGCCTCTATGCTTCTCTTGCTTCCCCTCTGGTCATTATCGTCGCGCCTTAT
GGAGCTCCCATATCCCCACCGGATGCACGGAATTGAAGCTGCACCGTCGTCTCAGCAGAAGCCCAGCAGGTCGAGCTAAC
CTGCTTCTGCCTCCATCACAGTGCAACGGACAAGGGGCATTTTCGGCGTCCCTTTGCGGGAGAGTATAACGTACGCAAAT
GTGGCCATCTCTCTGATCGACGACAACGGAAGGAGTTACATCTATGGTTATGTGCCCATTGTCGTCGCCAAGTGCGGCGT
CTTCCTCAAGGAGAAAGGTAAGCTGCGTCTGCTGCGGCCGCCCAGAGAATGTGGTCCGGGCTAATTCCAATAGCCACCGG
AATCGAGGGCATCTTCCGGCTAAGCGGCTCCGAAAAGCGAATCAAGGAGCTCAAACAAGCATTCGACTCCCCCGAGCGCT
ATGGCAAAGGCATGTCCTGGAATGGATATACCGTGCACGACGCCGCCAACGTCTTGAGACGCTACCTCAACGACCTGCCC
GAGCCGGTTGTACCGCTCGACTTTTACGAACCTTTTCGGGATCCCTTGCGCCACGCCGTCAAGCTGACAGGCGCCGACAG
CGATGGCCCCCATTTTGTCCCAAACTTCGACATGGCCTCTGCCATCCGCCAATACCAGCGTCTGATCACCGAACTGCCGC
CTCTCAACCGCCAGCTATTGCTCTACATCCTCGATCTGCTCGCCGTCTTTGCCGCCAAATCCGACGTGAACCGCATGAAC
TCACAGAATCTCTCTGCCATCTTCCAGCCCGGCCTGCTCTCACACCCCAGCCACGATATGGCCCCAGAAGAATACCGTCT
GAACCAGATCGTCCTCATCTTCCTCATCGAGAACCAGGACCACTTTCTGATCGGCATGCAAGGTACCGCCGCCGACGAGC
AGACGGTCAAGGACGTCCAGAGAGGCACCCCGCCCGTCACTCCCAGCATTGCCGTGGAGAGTCCCGGAGCCATTGGGGTC
TCTAGGACAGCGTCCAATGCCAGCGCGGGTGCCGAGAGTGTCGCCCGCGACGGCAAGATCCGCCGCAATCGCTCAACCTC
ATCGCGCAATTCCCGCCACTCCAACGGCAACAGCAACAGCCACGGCCACGGTCATAATCACAACCATAACCACGATCACG
GTCACAGCCACGTCGCACATACTCGCCCCCCGAGTCCTAGCAGCAGCAGTCCCGGGCTGATCGTGACGCCGACTGCCTCC
AGCTCCACAAGTGGTGGCTTGGCCCGGAGCAATACGCTGCCCGCCAGATCTCCCGGTCTCTCACCCGGGAGATTCAACAA
ACGAACGGATGCAACCGGCAGTCCCGTCTCCCCCCTCACCCCAATCACTCATCATTCTCCTCTGCATACGCCGACGATTG
AGCCGGTCGAAGAGGTTGTTACTCCGGCAGAGGAATCGTCGTTTCAGAGCCCATTTTCACCGGCTGCCGTGAAGTCAACA
CCACCTCCTTCCACGTCAGAGTTGGTCCTGGATCCGCCGCCTGACACCACAGGAGTCCCTGCTGTAGGAACTGGAACTGC
TGTAAAAGAAACGGGGGCTTCAACTCCGTCCAAGGATAGAATCCTTTCGCTCTTTCAGCGCTCACAGGTGGCCGACGGTG
AGCCGCGCCCTCCACCAAACAAGCTCAGAAAGAAGAGAATGCCGACCAGTGCAAACCCGAGCGCGCAGAGCTCAACGGCC
TCATTGCCGCCAGTTGCTTCGGCTTTTGCCTCGTCGACTCACGAGCTTGGAATCAATCCATCAGAGGCGCATGCAACAGC
ATCACCATCTCCAGCGGCTGCTGTAACGGCAACAGCAGCAGTAGCGGCAACAAAGGGACGCATCCCGCCCAATGAGCTCA
CTTCGCACCAAAAATCCGGCTCTTCTTCGGCTCCGCACGCTATCGACCTGACGCCCCATGCGTCCCAAGTTCCGTCTACG
GTCACGACGACTTCGACGCCGATGCCAATCCCGGCGCCAGATGCGGCTGCGTGTGAGGCCCAGCTCCGACCGCAAAGAAG
ATCGCTGTCACCGTCTCTGCACAGCTCCTTTAACGACGGCTCTGAAGCTGACCAAGCCGATGAGTCGACGGCTGCATCCA
CGTCAGACCATGCCGATCATTCCGAAAGGGCCAATAAGCGGAACTGGCGCATGTCAAGACGACGAGATGACGCGCCGCTG
ATGGGGCTTCTACCACCAGGAAGCAACTTGAGCGAAGTGTCTACCAACTCTCGGCCGGCCCTCAGCGTTGGGTCCAACGC
GAACGCAGAACTGAGCACAAGCTCAGTCTGCAGCGCCGGCCCAGCGTCAATCAGCGTCGCCGCACTCTCGCAGACAGGTG
CTAGCGGCTCGCCGGAACCGACGTTTGCGAACGCTGAGGCTACCATGTCGCAGGACTCGACCACAACTGCCGGCAGCAGC
AGGGATGGCAGAGACGGCAGAGACGGCAGAGACAACAAGGAGGGCAAGCTGTCCGGCTGGCTCAAGAACAAATATCGCGA
GGCCAAGGAGACCGCTGAGCATCGACGAACCAAGTCACCCACCTCAGAAGATCGATTGCCAACCACAAGTTTGGTGTCTG
GGCTGGCTCGCGGAAAGAGCCTCGATCTCAAGCGACCCGTCGAAGAGGACAAGAAGTCGAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62