GenePrediction:GLEAN_618 Details

Name: GLEAN_618
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:997153..999397 (+ strand)
Length: 2245
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:997153..997208 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_97:997289..997337 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_97:997397..999397 (+ strand)
Length: 2001
>GLEAN_618 class=GenePrediction position=GCSC_97:997153..999397 (+ strand)
ATGGACACAGACGAGGACCTGCTGCAGAGGCTTGCTGCTGGCGGCGCCATTGACTAGTATGTTGAGCTGCAAGGCAGGAC
CAATGGCATCTCGTCGGCGTGGACGCCCTCTCGTTTTCGCGTTAACCTTTCTGTAGCTCCGTGTGGCCACGGCTGCTCTG
CACGGTCGTCTCACGGCTGGAGACGGTAGGCCTGCTCTGCTTCTTTCCGGGGTGATCGATCCCCAAGGCTGACCATCTCT
CCAGATTGCCCACAACGACTTTTCCATACCCAACATTCCACCCCCCAAACCGCTACAGCTGTCTCCGCTCTCGCCCGTGC
GTTCGTCTACATCTGCTGGTGCAAATGGGGCGCACGTGGCCATCGCTGCTGCTCCGGCCTCGGACGGTGCTTCACCCTCT
CCGGACGCGAACAAGGAGAACACAACACCGGCTCTGAGCCAGACAGCAGAAGATCTAAGCAATGGCAGATCGGCCGGCAT
GCCGGCTACTCCTGTTGCGTCTGCTACTGCTGCTGCTGCTGCTCTCCCTGCTGTCTCCTCACCGCCGGGCTCATCCCATA
CGGAGGCCGAGGGGCCTCTGCCGGTACAGATCGCCGACCTACTCAACCGCATCATCACCACCCTCACCACCACCTTTGCC
CAGTATCCCCCCCACACTATCCAGCGCCTGTCTGAGCTGATCCTGACGCCGCGCCGGCACTACCGCAACGTCACGTCCTA
TCTGCATGCCGTCGACCGCGTTGCCACCGTTACCAGTGGCAGCAACACGTATCCGCTTCCGCCTGCCATTTCCGACATGT
CCGCCATGTCTCTGCTCGCCAACGGCGTCATTCCTTCTGCCTCGACTTCCGCCGGGGCCGCCGCGACCGCCAACGGCGAC
GTCTCTGCCGCTGCTGCTACCGACAGCGCCAACGCTTCCCTTAACGTCGGCAGCGACGAGGCCCTCGGTGGCGCCCTGCT
CACGCCCATTCCCTGGCTGCGGCCACGACCGAACAGCTCTGGGGACGAGCACACGGACGGCTCGAGCCCGCCCAGCTCTT
CCGACAGCGGGGATGGTATGATCGGCAGCGACGGCGATGGTGGCAGCGGCAGCGACAGCATCATCATCAGTGGAGGTCTT
GTCCTCAACACTCTGTCTGCGCAGTCAGCCCCGTCGCCCCAGCAACAGTCGCAGTCGCCCCAGCCTCAGTCACAGCAGCA
GCAGTCGTCACTGCAAGAGCAGCAGAGCCCGCAGGGCCAGAGCCAGAGCCAGCACAAGTCACCGTCGCACCGCATCGAAG
GCCATGTGCGCACCGAGAGCACTGAGACCATTGACGGACCCAATGGCGTGGGCAGCATCGAGACTGTCAGCGTGTCGGTC
AACGGCATCCCAAGCCACGGGGCAATGACCGCGGCTGTGCAGCTGCAGCAGCAGAGGGGCATTACGCAAGGCGAGCTCTT
GCGGCAGGAGCAGAAGGCTGGCGTGGTCCCGGTGAGCCAGCTCGCCCGGGCTGCAGCTGCTGCTGCTGCCGTCTCTGGTG
TGGCTGGGGGCAGCGGTGGTGGTGGAGGGGGCAACAATTTCAAGAATCACTTCCACGGTCGTATGGATGAGGACGAGGAT
GGGGCCGATGTGGAGGGTGAAGAGACTGGAACCAGCGAACAGGAGGAAGCCGGAACCAAAAGCAAGGATGGCGAGACACA
GGCCACAGAAGAGGACGAGGACGAGGAAGAGGTGCCACATGCACGGGGACCAGACGAGATCGGTGCTGCCGACATGGGCC
CCCAACCGGATCGAGGTAGTGACCCTCACAGCATCGACCTGGAGGCAGCCGTGGGGCGAAAGGCAGTGCCACTTCCCGGG
GCAGCCGCCGCCATATCTGGACGCCACGCAGCCACTATGAAAAAGGTGACAGCAGCAGAAGCAGAGGCCGGCAGCGCCGA
AGCAGTGCCCGAGACGTCGGTGGGACATCCTCAGATAGTCCGCGCCTCGACACCGAAGCGAGAGGCCGAGGAATCGCTCA
GGTCTTCCGTCCCGACGAAAAGGCTAAAGGAGGAGGAGGAAGGCAGCAAAATGGACACAGACACCGACACCGAGGCCGAT
GCGACCAAACCTGCAAAGGAAGCATCCAGGGACAAGGCCGCAAAGGAGCCGGCGGCCATGGAAGAGAAAAAGCAAGTCAC
AACGGCCATGGCGGTGGACCGGAAGAATCCGGCCAACAAGGGGAACGATACGGCGTCCAAATTGTCCACCTCTACCAGCT
CATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62