GenePrediction:GLEAN_6190 Details

Name: GLEAN_6190
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1719241..1718273 (- strand)
Length: 969
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1719241..1719078 (- strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_144:1718891..1718273 (- strand)
Length: 619
>GLEAN_6190 class=GenePrediction position=GCSC_144:1719241..1718273 (- strand)
ATGTCAACCACGATCGAGTCTCTCGGTCCGTTGACCACCACCTTCACCCCGTCGGCAACCTGTCTCACCGATCTCTACCG
ATACGCCTACGGCTTCGTCCACCTCAATGTGGACACGAGCACGTCAGATTGTATGCCTACGGGTTGGAACTACAACATCG
GCGCGTATTTCTCGCCGGGACTCTGCCCGTCTGGATACTCGGTAGCCTGTTCGTCCACAACGGCTGCAGAGACGGGGGCG
ATATGTTGTCCCAAGTAAGATAGAAAGAGAGAGAGAGAGAGAGAATGTGTAAAGACTGACCTCAAAGCCGGCTATGCATG
CCAGACCAGCACCAACTTGCCCTGGTACAGCACCAACCTCTGCGTCTCGACCATGGCCTCGACCCAGGCCTACGTCTTCT
ACAACGTCGTCGTCGGTCAGACCAAGAGCCTGGTCTCCAGCACCGGGTCCGAGGGCGTGAATGCCTTTGGCATTAGCATC
CGCTACAAGTCCACCGACTTTGTCTCGTCCACCACCACGACGTCCGGCTTGGCCACCACGACCGCCGCGGCCACGGCGAC
GCCGACGACGACGGGCGCAGCCGCTACGAGCACTGGCAGCAGCGACAGCAGCAAGAGCAGTGGCGGTGGGCTGAGCTCTG
GCGCCAAGATTGGCGTTGGTGTCGGTGTCGGTGTCGGTGTCGGTGTCGGTGTCCTGATCATCATCGCCCTCGTCGCCTTC
CTCTTATTCCGCCGGAGGCGCCAGGCGCAAGACATCCGGGCTGTCCCAGCCACCGACGACGTGCATTCCACTCCATCGCC
ACCGGCTCCGTCACCGCCGGCCAATTCGTACGGATACACACAGCCGCCGGAGCAAAAGTACATGCAGCAGAGTCTGATCG
CCGAGGCGCCACAATACGGCCGGTGGAACGGGCCGACAGAACTGGCAGAACTGGCGGCAGAGCCGGCAGAGCTGCCGGCG
GCACATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62