GenePrediction:GLEAN_6191 Details

Name: GLEAN_6191
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1716660..1714843 (- strand)
Length: 1818
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1716660..1716645 (- strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_144:1716562..1715918 (- strand)
Length: 645
Type: CDS
Source: GLEAN
Position: GCSC_144:1715846..1715744 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_144:1715693..1714946 (- strand)
Length: 748
Type: CDS
Source: GLEAN
Position: GCSC_144:1714875..1714843 (- strand)
Length: 33
>GLEAN_6191 class=GenePrediction position=GCSC_144:1716660..1714843 (- strand)
ATGTTCACCCCCAAAGGTACGTTTGTCCGCATCACTGGATATGCGCCGCTCTTACGGCGCTCCGTATCTGCGACGACTGC
TGACACTGTCGCGAACAGCGGCCTCGAACGGCCAGACGGAGCATGATGACGGCTCTGACAAAACGATGCCGCTGCCAAAG
GAGGATGTGCTGGCTTCAGACGACATGCCAGAGAAGGGTGAGACGGTCGGATCCATCGAGTCGGATGAGTTACAGGTGCC
GGTGCCGGCTCATACTACCGAGGCAGCCCTGATGCGCCGCATCGACTTCCGCGTCGTGCCCTTCCTGTCTCTGCTGTATC
TGGTCGCCTTCCTCGATCGCATCAATATCTCCAATGCCCGCAGCTTCGGCCTCTCATCGGACCTGAAGCTCACCGGCGTC
CAGTACAACACCTGCCTCACCATCTTCTTCGTGCCCTACGTTTTTTTCGAGATCCCGTCCAACTTGCTGTTGAAGCGCTT
CTCACCGCGCGTCTGGCTCAGCATCTGTGGCATGGGCTTTTCTGCCTGCACCGTCTTCCAGGGCCTGGTTCACAGCTACG
GCGGCCTGCTAGCCTGCCGCTTCTTCATGGGCGTCTTTGAGTGCGGCATGTTCCCCGGCTGCTTCTACCTGCTCGGCATG
TGGTACCGCCGCGCGGATGCTCAGCGCCGCTACTCCTTCTTCTTCTCGTCGACGTCACTGGCTGGCGCATTTGGCGGTCT
GCTAGCCTCGGCTATTGGAAAGAGTAAGCTTCTGTCCTAGTGCGCGGGGATGCCCAGTTCTCGGCCTTTACGAGCTCTCA
CTGACGCTGAATAGTGGACCACCTCCACGGTCACCGCGGCTGGCGGTACATCTTCTGGTTGGAGGGAGCTGTCGGCTTCG
CGATCTGCTTTGTCTTCCTGTTTACGTTCCCGTCGTTGTAAGCGTACATCCCCGTCGCTGTTCTCCGGTCCTTGCTAACT
CCTTTAGCCCGGAGCAGGCCAAGTGGCTGCGCGAGGACGAGCGCGCCTATATTCAGGCCCGTCTCAAGGCTGACCAGGGT
AACAATGCTGCGGAGCGCAAGATCACCCTGCGTGATGTGGGTGTGGTCATGCGCGACATCAAGGTGATCCTGGGTGGATT
CATGTACTTTGGGCTCATCGTGCCCGCCTACGGCTATGCATTCTTCGCGCCGGCCATCATCAGCACCTACCACTACGGCA
CGATCCAGACACAGCTGCACGCCGTGCCGCCATGGGTCTGTGCAGCTGGCCTGTCGATGATCGTGGCCTTTGCCAGCGAC
CGCGCCCGTCACCGGTTTCTCTTTGTGATTGGGCCCATCTGCATCGCCCTGACCGGGTTTGCCATGCTGCTCGCCATCCA
TGACAACGTGCACGCCGAGTACGCCGCTCTGTTTCTCATCTGCGCCGGCACGTACTCGGCCATGCCCGTCATCGTGTGCT
GGTACAGCATGAATCTGGGTGGACACCACCGTCGCGCCATCGGCATCGCATGGCAGATCGGCTTTGGCAACATTGGCGGC
ATCATCGCCACGTACGCCTTCGTTTCGACCGACTCGCCGCGATACACCAAGGGCTACTCCATCTCGTTCGGCTTTGTGTG
CATCAGCGCCATTGCGTCTTGTCTGTATGCGGCCATTCTGTTGATGGAGAACCGGCGGCGTGAGAAAACGGCACGCAATG
TTGGTTTGACCGAGTACGAGAAGACAGAGCTGGGTGTGAGTAACGAGAAGGCGATCCCCAAACCAGTTCCCCCTTGCCGT
TGCATGTTTGCTGACGAAAACACAGGATCTCAACCCCGACTTCCGTTACATGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62