GenePrediction:GLEAN_6193 Details

Name: GLEAN_6193
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1706508..1703222 (- strand)
Length: 3287
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1706508..1706410 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_144:1706316..1703430 (- strand)
Length: 2887
Type: CDS
Source: GLEAN
Position: GCSC_144:1703370..1703222 (- strand)
Length: 149
>GLEAN_6193 class=GenePrediction position=GCSC_144:1706508..1703222 (- strand)
ATGGCTTCGTCTTCGGCTAGGCGGCATCGCCTGGCCGAGGATGCCGTTGTCGGCCAGTTTGTCATTGGCGGCGAAATCGG
CAAGGGCAGTTTTGCCCAGGTCTTCATTGGCAAGCACAAGGCAAGCACAGCGCCCAATCGTCGTGGTTCCTTTCTCCCCC
CCTCGCTGCTGACTTTCCGTGCCTCTGATTAGGTTTCGGGCGCTGTCGTTGCCGTCAAATCGGTCGAGCTCGCTCGGCTG
AACAAGAAGTTGAAGGAGAACCTCTATGGTGAGATCAAGATCCTCAAGACCCTGCGCCACCCACACATCGTCGCGCTGCA
CGACTGTGTCGAATCGGCTACCCACATCAATCTCGTCATGGAATACTGCGAGTTGGGCGACCTGTCCATGTTCATCAAGA
AGCGCGAGAAGCTCGTCACCAACCCAGCCACACACGACATGGCTCGAAAGTATCCCAGTGCTCCCAACTCGGGCCTTAAT
GAGGTCATCACCCGCCATTTCCTCAAGCAGCTGGCCAGTGCCCTCAAGTTCCTGCGCGAAGGCAACTTTGTCCACCGCGA
CGTCAAACCCCAGAACCTCCTCCTCCTCCCGTCACCCCAGTTCCGGGATGTCCACAAGAGCACTCGTCCTATCCTTACCG
CTAGCAACGATTCTCTCATCCCTGTCGCCGGCCTGGCGTCTCTACCTATGCTGAAGCTGGCCGATTTTGGTTTCGCCCGC
GTCCTGCCCTCCACCACTCTCGCCGAGACGCTATGTGGCTCGCCCCTCTACATGGCACCCGAGATTCTCCGCTACGAGCG
GTACGATGCCAAGGCCGACCTGTGGTCTGTCGGCACCGTCCTGTACGAGATGGTGTGCGGCCGCCCGCCGTTCCGGGCCA
GCAACCATGTGGAGTTGCTGCGCAAGATCGAGGCGGCTGAGGACCTGATCAAGTTCCCTCGGGACTGCATTGTCACCACA
GGCATGAAGAGCCTCATTCGCGCCCTGCTGAAGCGCAACCCTGTCGAGCGTCTCAGCTTCGAGAACTTCTTCAACCACGA
AGTCGTCACAGGCCCCATCCCCGGTCTGGTAGAAGACGACATTCCCCGGCCCGAGCGCCAGCTGCTGGAACGTGTCCCTG
AGCGCCGCTCCACCAGGGACCTGCGGCAAGCTCCGACATCGGCACCGACACCTTCATCCTACTCCAGCCCGGCTGAACCA
GCAGCACCGGCGACGGCAGCCGTCACAGCCTCGGCGACACCGCCAAGCCGAAGGCACTCTTTCCGTCGATACATTCCCGA
GAGCGCTTCAGCCGGTGCCGATAGTGACCGAGAAGTGGCAGCAGCAATTCCGGCTTCGCCCCGCGATCGATCTAGCCGCG
GCGACCCTGGCGTCCAGCGGATGAGCTACTCACCGAGACACCATGACATTCCCGACGGCCTCGGAATCCGACGACCACAG
GCACAGCCGTCGGTGTCTGCGCCAAGTCGGCCAGGGCTGCATGATGATCGGAAACATCGGCTGTCAAGCGCATCTCTCAA
ACAGCAGTATATGCAGGGTAAGGACCAGCTGCTGCAAATGAAGAAAGAAAAGAAAAAACCGACAGCTGACAATGCCATCC
CTGCAGAAGCACCACGGAGCAGTCGTGGAGCCTTACTCTCCGAGGAACAGGAGCGGGCAGCCCAGGACATCGCCTTCGAG
CGGGATTATGTTGTCGTAGAAAAGAAGCACGTCGAAGTCAACGCGTTTGCCGACGAGATGGCTGCCAACCCGCGACTGAC
GGCACAGTACCAGGTTCTCGGAGGCAGCTCGACGACACCGCCCAAGACGATGGTACGCCGTGCCACACAGCAGGGGCACC
CAACATCATCTACCGGGGCCATTGCGCCAACGCCTTCACGGGCCATGCAGGTAGCCCAGGGCGCTCTCTCACGGCCATAC
CACGGCGAGCGGCAAACCTCCATGTCTGCCAGCCCGAATTCGACCACGTCGTTTATCGCCAAGGCAATCCACGACGCCAG
CTTCCGACTGCTGGGTGTCAAGAACCCGGCCGCCCTGATTGGCAAGGGTGCTTCGCCGCCACAGCTTTACAGCCCGTTCC
CATCCTACCCCACGCCGTCAGGGCCTCCGTCAGCGGCGCTCCTCACAGACGGCAGGCCGGGCAGTGGCGTTGACGACGGC
ACCGGCTACGGCGGCGGGTCGGCAATAGCGACAGGCGCTTCTGCCAACGGAGACGCACGTGTGGCTCTGCTGATCGAGGA
CTATGCAACACGCAGCGACGTGGTGTACGGGTTTGCCGAGGTCAAGTACAAGCAGCTGATGCCGCTGGCGCCATCAGCCG
AGCACGATCTGAGCGGATTGCCGGCGGCAGACAAGCTCAACACGCAGGAGGACGAAGACGAGCTCACGATCGATGCGATC
GTGGTGCTGTCGGAAGAGGCACTCGTGCTGTACGTCAAGGCACTCTCACTGCTGGCCAAGTCGATGGACATTGCCGGCAT
GTGGTGGAAGACGAAGATGCGCGACATGCCGGGCGATACTGGCCGTGGCAGCAGCGGCGGTGGCGGTTATGTGGCAGTGG
TGCGCGACTCCCCGCTCGGCCAGCGCATCAACGCAGCAGTCCAGTGGGTGCGGTCGCGCTTTAACGAGGTGCTGGAGAAG
GCAACGTTTGCGCGCGAGCGACTGCTGGAGGCGCAGAGGCGACTGCCAGTGGACCACCCCAGCCACCCAAGCAACCACAA
CCGGGACCCAGTTGGCAGTGCGGGCAGCTCTGGGGGGGTGAGCACAGACGGCGTGTTCCTCAGCAGTGGTGTCAGTGCCG
AGAAGCTTATGTACGATCGCGCAGTCGACATGAGCCGGTCGGCAGCCATTGGCGAGATTTCTAACGACGATCTGGCTGGC
TGCGAGCTGTCGTATGTGACGGCCATCTGCATGCTGGAGGCGGTGCTCGATACAGACGAAGACGCGACTGTGACCCCTCG
ACGGAAGGTGTCTGGTGGCGGTGGTGGTGGCAGCTCTGGCTCGTACCGGGATGAGAAGTCGATGCGTGAGGAAGACACGG
GCGACATCAATATGGAGGACCAGAAGACGGTGGAGATGAGTATGTGTTCTGCCCCCCTGTGGCGTGTGCGTGTGAGTCGA
CCAGAAGCTGACCAACAGTGATCACGATGATCAAGCAGCGGCTTGCTGCAGTGCGTAAGAAGGCCCGTCTCATCTCGAGC
CATTCACGAGCGGCACAGCAGCAGCATCTCATCCGACGACGCAGCGGTGATGTGACTCCTCGCAGCGTTCCATCGCACGC
GTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62