GenePrediction:GLEAN_6194 Details

Name: GLEAN_6194
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1696646..1696233 (- strand)
Length: 414
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1696646..1696233 (- strand)
Length: 414
>GLEAN_6194 class=GenePrediction position=GCSC_144:1696646..1696233 (- strand)
ATGGAAAATAGGGAATCCAACGGAATCGGCCATGCTAGAGAGTATGTCGATGATTCGGCACAACAATCCGAATACGTCAA
AATCGAGGAAATGAAGAAACGAGTAAAAAATGCCGGGGGCACCATGTCACAACCCCAGCTACACGGCCCAGAGCCAGAAA
AAGGCAGTCAAGAGCCTGGCTGCGTGGTCACCGAGGAAGCTAAGGATACTTCTCCCCCAAACCACGCATCTGTTCGTGTT
CATTCGGAAGAAACCTCAGTTGCACTCCCTAAGCCAGAGTATCGAAGCGTTCCCGCGCATGTCAAGCGCAGAACGGATCA
CAAAATTCATGCTGTTCAACCACCGGCCAATGCGTCGAGCTCGCGACCAGTCCCAACAGACCAAAGAAAGAATCACTCGT
CCCGGAAGCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62