GenePrediction:GLEAN_6195 Details

Name: GLEAN_6195
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1690116..1688852 (- strand)
Length: 1265
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1690116..1689115 (- strand)
Length: 1002
Type: CDS
Source: GLEAN
Position: GCSC_144:1689052..1688852 (- strand)
Length: 201
>GLEAN_6195 class=GenePrediction position=GCSC_144:1690116..1688852 (- strand)
ATGCAACAGCCACCACCACAACAGCCTGGGCAGCCGGGCGGGCCGCCCATGCGGCCGTCGCCCGAGCAGATTGCGGCGAT
GCAGCGGCAGATAGCGCTCGACGCCCAAAAGGCGGGCATGACGGTGCCGGAATTTATCCAGCAGCTGCAGAAGGCGCGCG
AGCAGATGATCCGACAGCAGGCAGCCCAGCAGGCAGGAGGCGCGGGCCAGCCGGGGCAGCCAGGTCCACCAGGGCAGCCT
GGGCCGCCGGGACACCAGCACCCGCACCCACACCCGCCGCAGCAGGGAGGCGCGCCGGCGGGGCAGCAGCAGGCAATCAC
GCCGGGTCCGCCGAACCCGGTGGCAGTGGCGATGGCCAAGTTTCTGCGGGCACAAGACCTGAAGACGCGGACGGTGATTC
TGGGCGGCGAGCGCAAGGACATGTTCCGGGTCAAGCGGGCGCTGCGGGCGCTGCAATCGCCGGCGTACGAGAAGGCACGG
CTCAAGACGCCAGATCTGCCGACGATCACAGACCGGGCGTCGCTGGAGAATGCATTCAAGCTGCTGCCGCTGTCGATGTT
GGCGCTGCGCGTGGCCAAGGCGGAGGAACCGGCAGCGGCGCAGGCGGGCGCAGCAGGCGGGGCCAAGAAGAAGACGAAGC
GCATCAAGGGCCAGTGGACGGTCAACATTGAGCGGCAGCAGGACGCGGGCGATGACATGTATTACGTCTGGTTCTACGAG
GGCCCACAGACCATGCGCAAGGTGTATGCCGGGCTGGCGCTGCTGGCCATCTTCGCCGTGGTGCTCTATCCGCTCTGGCC
ACTACGCATGCGCCAGGGCGTCTACTACCTCAGCTGGGGCTTCCTCGGGCTGCTGGGCCTTTTCTTCCTCATGGCCATCT
TCCGTGTCGTCCTGTTCTGCCTGACGTACTTTTTGGTATCGCCCGGCCTCTGGCTGTATCCGAACCTGTGGGAGGACGTC
TCGTTTATGGACAGCTTCCGGCCTGTTTGGGCCTGGCACGACGTGAGTGTATTTCCTGGTCTAGGCTGCCGTTTTTGCCT
TACTGACTTTGCTTTTCTCCCCAGCCGAACCCGAAGAAGAAGAAGAAGTCCAAGTCGTCGTCCGGCACCTCGGTCGAGGC
TCAGTCACACTTTGCCGGCACCACGGGCCATGTGCCGCCCGCTTCGGCTACCACGACGGCTACCACCACACAGGCCATGG
CTGTGCCGACACAACGACCAGCCGGCTACAAGGCGCCGCAGGTGGAAGAGGTGGAAGACGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62