GenePrediction:GLEAN_6196 Details

Name: GLEAN_6196
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1686810..1683682 (- strand)
Length: 3129
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1686810..1686594 (- strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_144:1686526..1686353 (- strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_144:1686280..1686270 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_144:1686211..1685944 (- strand)
Length: 268
Type: CDS
Source: GLEAN
Position: GCSC_144:1685887..1685744 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_144:1685679..1685580 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_144:1685518..1684225 (- strand)
Length: 1294
Type: CDS
Source: GLEAN
Position: GCSC_144:1684170..1683682 (- strand)
Length: 489
>GLEAN_6196 class=GenePrediction position=GCSC_144:1686810..1683682 (- strand)
ATGCAGAGCATTTTTGCAAAGATCGAGGGCGGCCTCGAGGACCTGGTGGGCGGCACCGAGAAGCACTCGCACACCCACAG
TGCCGAGTGTGCGGAGGCACACTCGCCCGAGCACAACAGCAACCGGTTCCAGTCGTTTGCTCCCGAGACCGCCGGCCGGG
CCAAGTGGTACGTCGACGGCTGCTCCTACTTCTGGGCCGTGTCGGAAGCACTCGCGAGTGAGCATACAATCTTCCTATAG
TTATTATTGTTTCGCTGTCTGCAGACTGCTGACCGCAAGACTAGAGGCCCAACGGACCATCTACATCCTCGACTGGTGGC
TGACGCCCGAGCTGTACCTCCGCCGGCCACCGTCCAAGAATGAGCAGTACCGCCTCGACAACATGCTCAAGGCCGCCGCC
GAGCGAGGCGTCCAGGTCCGCATCATCGTCTATAAGGAGGTGCCGCAGGCCCTGACCTGTACGTGTGTCCCTTACCTACT
GCTGGTTTGACCGAGTCGTGCTGTCCTTTGCTAACCCCGGCCTCTTCCAGTGAACTCTGCCGTATGAACACATCTCCTGC
TTGCCTGTGTCCGGCCTCATACTGACCAAGACCGTACAGCACACTAAGCACGCCCTCGAGGCACTGCACCCAAACATCCG
CGTGTTCCGGCACCCAGACCACCTGCCCAATGGCCATGACATCCAGGCCGATTTCGAGACGGCTTTCTCCAACATGAGCA
TGGGTGCCTTTGACCTGTCCAAGATGGGACAAGATGCCCTCAAGGCGCTGTATGGCACCAGCGATGACATGGTGCTGTAC
TGGGCCCACCACGAGAAGCTGTGTCTCATCGACGACCACATTGCCTTTATGGGCGGTCTGGATCTGTGTACGCGATACTC
GTCCCCTGTTGTTCGATGCCGAAGACTGACATGGATACGACAGGCTTTGGACGTTGGGACACCAACAGTCACCCTATTGC
CGATGCCCATCCCGGCGACCTAGATGCCATCATCTTCCCCGGCCAGGACTACAACAACGCCCGTGTGTACGACTTTGCTG
ACGTCGACAAGTGGGAGAACAACAAGCGTGCGTATAGGCCCCTTTCCGCCCAAGAAGACGCCTCGTCCTGCAGAAGCTCA
CCATATTCCAGTTGACCGCACCCAGAGCTCGCGCATGGGCTGGTCCGACATCAGCATCAGCCTGTCGGGACATATCGTGC
CCAGCCTGATAACGCACTTTATCGACAGATGGTGAGTCAGAAAAGCGCTTTCTGTGACTGGTTTTTATGATGTTCACAAG
CTCTGCGTGCAGGAACTACATCTTCGACAGCAAGTACGTGACCCGTAAAGAGGGCGCCTACGAGAAGCTTGGGATGCCCA
GCGAGCCGCACACCGTGCCTGAGAGCCTGTGGGGCAATGGCGGATCGCTGCTGGAGGGCGGACAGCGCTTCGTGGGCGGC
CTGCACAAGCACCTGCAGCACCGCATGAACCAGTTCTTGGGCGGCGGTGATGGCGACGAGGAAGCGGAACCCACGCGGGG
CGGCAGCCACGGCGGCAATTACGGCGGCAACCAAGGCGGAGACTACGGCGGCGACAATGATGATAGCATGCATATTCAGC
TGACACGCAGCTGCTGCGCCTGGTCGGCCGGTCACCCGACAGAGCACTCTATCGCGAACGCATACATTGCCGCGATCACA
GGCGCCGAGCACTTTGTCTATATTGAAAACCAGTTCTTCATCACAGCCACGAGCGATGAGCAGCGCCCGGTGACCAACAA
GATTGGCCGTGCCATTGTCGACCGTATCGTGCGGGCCCATCAGAACGGCGAGGACTTTGGCATGATCGTGTGCATCCCGG
CGGTGCCGGGCTTTGCCGGCGATCTGCAGGCCGACTCGGCTCTGGGCACCCGGGCCATTATGGAGTTCCAATACAACAGC
ATCAGCCGTGGCGGCAACAGCATCTACGAGGAGCTGCGGGCAGCCGGCGTGGGCGAGCCGGAGCAGTATCTCCGCTTCTA
CAACCTGCGCAGCTACGACCGTATCAACACGGCCCCGCTGATGGGTCGGATCGAAAAGGATAGCGGTGTGTCGTATGGCG
ATGCCCGGCGCGAGTTTGACGATGCTGTCGAGTCTGGCTACGATGGCTACAGCCGTGACCACGAGACCCATGGCCACCTG
GGCGACAACTACCATCGCTACCAGGCTGCTGCTCGGGCTGCTCCCAACGACCCTACCGCCGACACCGTCTCGGCCTGCTA
CACGTACGGAGGCCCAGCACTCGTCGACGTGCCCTGGAGTGGTGAGGACCCGGAGGCCGAGATTGCTGCTTATGTCAGCG
AAGAGCTCTATATCCACACCAAGGTCCTCATTGCCGACGACCGGCTGGTCATCTGTGGCAGTGCCAACCTCAATGACCGC
TCGCAGCTGGGCAACCACGACTCGGAGATTGCCGTTGTCATCGAGGACCCGAAGCACCCGGTACGCTCGTCCATGAACGG
CCGCCCGTATGTTGTCGGTGCTTTTCCCGCGAGCCTGCGCCGCCAGCTGTTCCGCAAGCACATTGGCCTGCTGCCGGACC
TGCCGTACGACAGGCCAACGCATAACGTACGTTTTCCACAAGAGACTTTACCAAGGTCATGTGATGCTGACTAATCACAG
TTCCTCCCCGTCACCGCTGGCCTCAACGAGTACGACTGGAACAGCACGGCCGACCGGCTGGTGGCCGATCCGCTCAGCCC
GCACTTCCGTCGCCTGTGGACCGGTACTGCCCACACCAACACGGAGGCCTTTGACGACGTCTTCCACTGCGTGCCCACCG
ACCGCGTGCGCACCTGGGACGAGTACGACGACTACTTCTCCAAGTACTTTGTCCTGCCGGGCACCACGGACGACAAGAAG
GACAAGGCCAAGCTGGGAAGAGAGGAGTGGGAGGACAACAGCGCGGAGCCGCAGCTCCTGCCCGATGGCAAGGCTCCCTA
CGGCCACGTGGCGCCCTGCTTCCCTGGTGGTGTTGAGGCCTTGAAGAATCGTCTGGGCGAGATCCGTGGAAACCTGGTCG
AAATGCCGCTGCAGTTTCTTGTAGACGTTGATGACCTGGCCAAGAACGGCATTACGTTCAACGGCCTGACCGAGGAGATC
TACACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62