GenePrediction:GLEAN_6197 Details

Name: GLEAN_6197
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1679874..1678150 (- strand)
Length: 1725
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1679874..1678632 (- strand)
Length: 1243
Type: CDS
Source: GLEAN
Position: GCSC_144:1678568..1678150 (- strand)
Length: 419
>GLEAN_6197 class=GenePrediction position=GCSC_144:1679874..1678150 (- strand)
ATGGGCGGACAGCAAGCGGTGATACCGTCAAAGCGGGCGCTTGACGAAGCCGATGCTGGAGTTGGTAAAGATCCCAGAGG
CATTGTCATCAAGTCCCTGTCTGTGCCGGTCAGTCCTCCATGGAAGAGGAGGCGGAACGGGGAAGAGGCGCATGATAGCA
CCAGCACCGATGCCGGAGTGCGGTTCAGGAGTCCGTTTCAGCTGACGGCCATCCGTGACCTGCCGGCCGAGGACAACGTC
GACACGGTGACGGTGGACGAGATATTTGGCAGCCCGTTGGTGGCCGAGTGCTGGGAATTCAATTATCTGCACGACATTGG
CTTCTTCATGGACGCCCTGAACGAGGACGTGCGCCACCTGGTGCACGTGCACGTGGTGCACGGCTTTTGGAAGCGGGAGG
ACCAGCGGCGCCTCGAGCTGGAGGCCGAGGCCGCGCGCTACGCTAACGTGCAGCTGCATACGGCCTTTATGCCGGAGCCG
TTTGGCACGCACCACTCCAAGATGGCAGTACTCTTCCGGCACGACGACACCGCGCAGGTGGTCATCTACACGGCCAACAT
GATACCCCACGACTGGGCGAACATGACACAGGGCGTCTGGCGCTCGCCCCTACTTCCGCTCCTGGCCGATGATGTCGACG
GAGAGGACGAGAGTGAGATCGATGGCCCCGTTGGGAGCGGTCGTCGCTTCAAGACGGACCTGCTCAGTTACCTGAGGGCC
TACAACCAGCGGCGCTCCATCTGCCGGCCGCTCGTCGAGAGGCTGGCACGCTACGACTTCGCGGCCGTACAGGCTGCCCT
GATCGCCAGCGTGCCGGGCAGACATTCCCTAATCCGACAGCCCGACGAGAAGTATCACACCCAGTGGGGATGGACAGCTC
TGAAAAACACTCTTCGCTCGGTGCCGGTGCAGGCAGTCGCGCCCTCCACCGAGATCGTGCTGCAGGTGTCCTCCATGGCG
ACGCTGGGACCCACGGACGCATGGATTCGACACACACTTTTCAGTGCGATGGCCACGGCTAGTAGTGCTGTCGATAAGGG
CGGCAGCATCGGCAAAGAGGAGCTACAGCAGCCTCGGTTTCGTGCAGTCTTCCCCACGGCAGACGAAATACGGCGGTCAC
TGGAGGGCTACAAGTCGGGTACTTCGATTCACACCAAGATACAGTCATCGCAGCAGCAGAGACAGCTGCAATATATGCGG
CCGTTGCTGTGCCATTGGGCCAACGATTCGCCTGATGGGGCGAGTATGTATCTTTCTCCCTCCCCCTTACTGGGCGATTA
CGTACAACACCCCTGACAAGAGCCAGAGCTCCCAGATGGTGCCACCCCGATTGTAAATGGCCGCAAACGGGCAGCGCCAC
ACATCAAGACATATGTGCGATATGGCCAAGTCGGCGTGGACTGGGCATTGCTTACGTCAGCCAATCTGTCGAAACAGGCC
TGGGGCGAGGCTGTGACTGCAGCAGGTGAGGTGCGGGTTGCATCGTGGGAGATTGGCGTGATGGTCTGGCCGGGCCTGTT
TGCGGAGACGGCTGTGATGCAGATAGTCGGCGGAAGCGACAGCGTGCTGCAGCCGGCGACCGGAAAGGCTGCGGGGAGAC
CAGTAGTGGCCCTGCGGGTCCCGTACGATCTGCCCCTGCAGCAATATGGCAAGGGTGAGATACCGTGGGTGTGCACGCTA
CCTGACGAGGAGCCCGACTGGACCGGACAAGCGTGGAGCGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62