GenePrediction:GLEAN_6198 Details

Name: GLEAN_6198
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1668276..1666164 (- strand)
Length: 2113
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1668276..1667559 (- strand)
Length: 718
Type: CDS
Source: GLEAN
Position: GCSC_144:1666870..1666414 (- strand)
Length: 457
Type: CDS
Source: GLEAN
Position: GCSC_144:1666362..1666164 (- strand)
Length: 199
>GLEAN_6198 class=GenePrediction position=GCSC_144:1668276..1666164 (- strand)
ATGTCTTTAGCCGCGCCTGAAAGCCTTTCGCAACAGTCCGCCTTTGATCAGGACCTGCAGGCCTCGCGCGTGTACAAACG
CACGATTAAAATTCGGAATTCTATGACGTTGCTAAGTAGCACGGCGCTGTACACTACGGCCCTATCAATGTTCTCCAACA
TCTCCTTTTGTGTGTTACCTATTTACTCAACCGACCTAAGTAACAGCTTCTGCTACGTCTTTGGTGAAGAAGGCGCGTTA
CGCAGCGATAGACAGGGAGGGGAGCAAGAACGGAAATCATGGCAGTCTCCGGAAGAAAAGTTCCTGTATGTCGAGGCATT
TTTATCCGATTTTGGCCCCACAAACGCTTTTAAAACTTATACTGAGATTCCCAGCGCTTCCCAGGAGTTCTCATTCGATA
CCAGGCCAATCGTCGCGAGGTTCTTGAGGAGGAGAGCGCCTGTGCCTTCGACTACGAGGGCTACCAGTGCCGAAACACTG
GCCAACCATGTGATCATGCGTCTAAAGCTTCATGATGCTGAGGTGCAAAGTTTTGACCAGGTGGATCAGGAGCATGCACA
CATCGCAGGCAATAACTTCCTGACCAACGAACAGCTCATCTCAGGCACACAGCTGCTGCGGGTAGCTGAGAAGATGCCTA
AGGGTGCACACCTACGCATCAACTTTAACTCGCACTTGCTTCTGACTGCGCTGCTAGACGTGGCTAGTAGCATGCGTCGT
ATGTTTATCATGAGTAGCCTGCCATTAGTACTAACCGACACGGCCAAAAAGGCCGTCACAGACGGGGAGTGCAGTGCGAT
AGACACACCAAATTTTCTTTCGTCTGAGATTCAGTTCTCTATTCTCTCTAAGGATGAGGAAAACCCGGGTGATATGTTTA
GCGCGGCGTACAAACCGTGGCAAACGATGCCATTGAGAGAGTTCTTAAGGAATTTCCCAGGATACACAAATATATCGGCT
AGGGATTGGCTACTGTTAAAGCTCAGCGAAAAGGTGACACACGACATTCCGCAAATTTCTGGAAGGTAAGATACGTCCAA
CGATTCACTGCCATTCATTAAGCGTACCTAAAATTTCCCTGCGCAGGACATGGCAACGTTTAAGTGGACGTACACAAATG
ATGAAAGGCCTGCTTAATTACGCGACTGCTTACAAGATGCACACGGAGTTGTTTCTGCAAGATCTACTGGACGACAATAT
CTAGTACGCAGAGATACGACCGACCTTTATGGTGTTAAATTATTTGTTTAATGACGAAGGCACAGAAACGATAAACAGCA
CAGGCATCATGGAGATTATTATAGATGTGTGCGAAAACTTTAAAGTGCAGCAGACGCAGGACCATAGGCAACGTTACTTT
AACGGGATCAAAAGCATCTACTGCACTCTACGGTCGCTTTCGCCAGAGTTACTGGACCTAGCGTTGATGGAGTGCCTCAA
CTTTAAGAAGCGGTGGCCGAACTACATAGCAGGCTTTGATTTAGTAGCCGAGGAGACGAAGGGACACCGACTACGCGAAT
TCGTGCCCAAGTTACTAGCGTTCCAAAATCAGTGCACACACGAGGGCTTCGATATACCGTTCCTGTTCCAATGCGACGAG
ACGCTGGACATAGGCACAGAGGTAGACAACGACCTCGTTGATGCGTTACTGCTAGGAGCAAAACGTATTGGACGCGGCTT
TGCGATGCCGCGCCACTCAAGAATCTTACATCAGATGAAGCAAAGGGGCATATGCGTGGAAATGTGTCCAACTTCGAACG
AGCTGCTAGGACTAACGCCGCGCATCAGCGGTCGTCTTGTTAACAATATGCTAGCAGAAAACATGCCGTGCACGATAAAT
AGCGATAACGGCATGCTTATTAGGTAAGTCACTTTCCTTGACGACGGACTTCCTAACATAAACTAACTCTTCAGGTCTTC
CCTTTCGTACAACTTCTACCGGATTATAGTTGGGAAGGCTGACATGGGCTTGTTTGGCTGGCGGCAGCTAGCCGAGTGGA
GCCTCGAGCACGCTTGCCTGTCGAACGAAGAGCTGGCAGAAGCAATGGGTAACTGGCTAGAGGCGTGGTGTCACTTTGTG
GTGTGGCTGCTAGACATACGACGACCACAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62