GenePrediction:GLEAN_6199 Details

Name: GLEAN_6199
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1664912..1661818 (- strand)
Length: 3095
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1664912..1664750 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_144:1663668..1663304 (- strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_144:1663239..1661818 (- strand)
Length: 1422
>GLEAN_6199 class=GenePrediction position=GCSC_144:1664912..1661818 (- strand)
ATGAGAACCACACGCATCATCTCGTTGACGAACATGTGCGTCGCCACGTCGGCGCTGGCGTTCCAGGTCTTCGTCCTGTA
CCCATGGCATCACCAGCTGCAGCATGACTTTGAGGACCTGAAGCGCGAACACATGCGCGTCCTGAAGACCATGGGCAGCA
CAGGTGCGCTTGCGGCTCTTCGCCAGAAGCAGACGTAAGGGAGACGCGAAGGCGAGGGTGGTGAGAGAAGACGGCGACTG
CCACACCAGACCGAGATGGCGCCGATTCGATCGATAATAGAGGATGGACCGATCTGTTCTTGACAAGGAGAGAAGACGAC
ATATACACACGCTCGAGGTGTTCATACCTGCAACCAATTTTCCTTTTGTGTTTTGTGTCTGCCTAGCAGACTTTGTTTGT
CAGTTTTGCATTTCCACAGGCAGCATTGGAGGGTCGCGCATTTTAGATAGAGTTTTGTATTATCAAAGCAACTTTGCTTT
CTTCAAGTCGTGTCCGTGTCGCTGTAGCCTCTCGAGCTTTCCATGATCGCAGCCGGCTGCGTCCTCTCTTATATATACAT
GGTAATCTGTCCTACACAGAAGTGGTGCCATGCATGGGTGGTAGCCCTGGCCGCGAATGGAGCCCTGCGGCTGTGGGGGA
TCGAACCTTGATCGTACGAGCTTGGCTGGTACGAGTATCTTACTATGCAATAGTAGGCAATCTCACAGCCTCTCAAGTCG
CCCTACCCACGGTCCCGACGGGGCTGGCAGACGCATGCGACGTGAATGCCGTCCATCTTACGATTCGGCCCCTTTTCCGC
CAGCTCGATCGATTGGCCGTCGCCAGCGGAGCGCCAGAGCCTGAGCAGCGCCGCGCCACAGGGCTGCCTAACAGCCACAG
GCTACGTTGTAGGCCGGCCGGCTGGGATCGGGATAGCGGGACGAGGACGAAAATCCGGCCTGGGAAAGACCAATTCGAGC
ATTTTGCCCCGAGGCAACAAAACTGTCGGCTTCAGCAAGCGAAACGAGTGAAAGCCATCACCGGCTAGCAACCAACCTCC
CACCACCACTACCATTGGGCGGGGCGCTCAGCCTGCGTGACTGCTCCAGCTCCCGCTAGAGTGCTCTGTTATGCCGCTCG
CCTCCCGGAATTAGGATTTACGGACGTTCTCTGTGCCGGAGCCTCTCACACAGGCTCCCTTCCCCATATATTTCTTCTCG
CCTCTTATCTCCAGCTTGTATCGTCTCTCTCTCTCTCTCCACAGTGATGATCCGCAACCCCCAACATCTGGTACTGCAAC
TCTCTGTTGCTCCCACCAGACGGTCCATCTCGGCAGCAGCCTCGTCCTATCACGGCTCCGAAAAGGCTCCTCCGGCAGCC
GTGGCCACCGCGACAGCCACTGCGACAGCCACTGCGACGCCGACCAAAGCAGCGGTGCGCGCCGTCAGGATGAGCGTCGA
GCCGGCACCGTCGTCGCCCTCATCGGCCATGGCCCAGCCACGATCGCGATCGGAAGAACGCCCCCCGTCATCGCCGTCGT
CACAGGCCAAGGCCCAGGTTTCGACCGAAGGCTCGCGCCGTGTTCTGTCATACTTTCCGCTGGGGTACAAGGAGGCGGCC
CAGCAGTGGGTATGTCGTGTGGAAATGCTGTGATCGGCCGTCTGTCTGTCGTTCCCGTTGCTGACTCTTCCAGTGGACCA
GCGTCTCAGCCTCGGCAGCAGAGCGAGGCGTGCTCTCGCATGTGCGGCATCTGTGCGAGGCCAAGACCGGCTCACAGCCA
GATCTTGCGCCGACTCCTACAAAGGACCCCTACGGACCCCGGCTTTGGCGGTCGCAGATGGTGACCCTCTCGGGCAAGAA
CCGGGCGCTCAACGAATACTCGATCGAGCGGACGGGCGAGGAGGCGACCGACACGCTCGTCATGCTGCATGGCTACGGAG
CCGGACTCGGCTTCTTCTACCGCAACTTTGAGCCACTCAGCCAGGCGCCCGGCTGGCGGCTGTTTGCTCTCGACATGCTC
GGTATGGGCAACTCGTCGCGGCCGACGTTTCGCCTGCACGCCAAGGACAGCGACGCCAAGATCACCGAGGCCGAAGCCTG
GTTCGTCGACGCGCTCGAGGAGTGGCGCCAGGCCCGTCGCATCGAGCGCTTCACCCTGCTGGGACACTCGCTGGGCGGCT
ATCTCGCCGTCGCCTACGCCCTCAAATATCCCGGCCACCTCAACAAACTGATCCTGGCCTCGCCCGTCGGCATCCCCGAG
GACCCCTACGCCGTCAGCCCGGACCTGCCCGAGCCCCAGGAGTCCACCCTGGTGGCCGAGTTCGCGCAGGATCAGCAGCA
GACCGTGGCCCCTCCGGGCGGCCATGTTGTCAAGATCTCGCCCAGCTCCTCAGCCACAACTTCCAGCCCAGCCACAACTC
CCAGCCACAACTATCGCTACAACCATAACCACCTCAACAAGGCCGCTGCTGCCAGCAGCAAACGTCCTGTCCGTCGACCG
CTGCCCAGTTGGCTCGTCTGGCTCTGGGATGCCAACGTGTCGCCCTTTACGTTTGTGCGCGCTTCCGGGCCGCTGGGCCC
CCGTCTCGTCTCCGGCTGGACATCACGCCGCTTCAGCCACCTGCCTGCCGACGAAGCCGACGCCCTGCACACGTATTCCT
ACAGCCTCTTCCGCCAGCGCGGCAGCGGTGAATATGCCCTGCCCTATCTTCTGGCCCCCGGCGCCTATGCCCGTCGCCCC
GTCATCAAGCACATCCAGGACGTCGGTCGCCAGCTCATCCCACCGTCCGTTGCTGCTGCTACCGGCACCATGGCCACCCG
CGAGACCGGCTACCCTATCGTCATGCTATACGGTGATCACGACTGGATGGATGTCGCTGGCGGCTTTGCGGCCGAGCACA
AAATCAATTCCCGCATCGCCCAATCGCGTCTGGACGGCTCGCCCGACACCGGCAGCGCAAAGGTTATCCTCGTTCGCAAC
GCCGGCCACCACCTCTATCTGGACAACCCGGACGACTTCAACAAATACATCCGCACCGAGCTCGATGACACCAAGCTGTC
TGAAGAGCAGCGGAGAAAGCAGCAGCAGCAGAAGGAGCAAGCCTCCCTCACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62