GenePrediction:GLEAN_619 Details

Name: GLEAN_619
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1014697..1016372 (+ strand)
Length: 1676
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1014697..1014939 (+ strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_97:1014994..1015210 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_97:1015270..1016372 (+ strand)
Length: 1103
>GLEAN_619 class=GenePrediction position=GCSC_97:1014697..1016372 (+ strand)
ATGTCCCCCGTATTCAAGAAGGACGAGGAGCTTTCGAGCTCTGAAAAGTATGGCACTACCGACGTCGCCGTCGGCTACAT
GGGCGACGAGAATGCCATACACTCCGACGAGCTCACAAGGGGCACCGGCTTCGTTGGCCGCCTAAAGGCAATCGGCGCCA
AGCTGGGTGTCGAGCAGCGCGGTATCGAGCGCGTGCCTAGCGATGAACGGACTGACACGAGCATGTCCTCGGTCGGCACT
CTCGTATGTTCCCCCGGTCTTCCAAGTACTTTCTCATGTCTTGGCTAACGCCGTCAGTGGCTCTCTGCCAATATGGTGGT
GTCTTCGTTCGCAATTGGTGCTCTGGCCCAGCCCGTATTCGACTTGGGCTTTGTCGACACGGCCTTGACGATCATCTTTG
TCAACATTCTCAGCATCACTCCTGTCTGCTTCTTCTCCATGTTCGGTCCTCGCTTTGGCCTGCGCCAGATGGTCTTGTCC
CGCTTCTTCTTTGGCTACCAGTCCGGCAAGATTAGTGCGTCTTTCCTCACCGCATCCGCATAGCTTCCCTTTCCGTCTCG
CCATTGCTAACAGATGCAGTCGCCTTCTTCAATATCCTGGCCTGCCTGGGCTGGTCATCCGTGAACGTCATTGTCGGTGC
CCAGCTGTTTCATGCCGTCAACAACGACATGCCTGGTTGGGCCGGTATTCTGGTCATTGCCATTTCGACGCTGCTGATCT
GCTTCTTCGGTTACCGTGTCGTTCACTTGTACGAGCGCTATTCGTGGATTCCCTGCTTCATAATTTTTCTCATTGTTGCT
GGCGAGTTCGGCCACTCTGGAAAGTTTAACAACATGCTGCCTCTTGCGTCTGGTCCCTCTGAAGCTGGCGCTGTCCTGTC
CTTTGCCGCCTCGGTCTACGGCTTCGGTACCGGTTGGTGCTCGTATGCGGCGGACTACACCGTCTACCAGCCTGTGGATC
GGTCGCGCAAGTCCATCTTCCTCTGGACCTTTGCCGGTCTGTTCTTTCCGCTCATCTTCACTGAGCTTCTCGGTGCCGCC
ATCATGACGGCTTCCGTCAACGACCCGGCATACTCGCAGGCTTACTCGGACTCCGGCATCGGCGGCTTGCTCACCACCGT
GCTCGTCCCGCCCTTGGGCCGCTTCGGCAAGTTTTGCGTCGTCATCCTCGCCCTGTCCATCATTGCCAACAACTGCCCCA
ACATCTACTCTGTGTCGCTGTCGCTGCAGGTTCTTGCTAAGCAGACTGAACGCCTGCCTCGCTTCTTCTGGGTTCTCATT
GGCACCGGTATCTACATCGCCATCTCCATCCCGGGTTACAGCCATTTCGAGTCGTGGCTCGAAAATTTCATGTTGATTAT
CGGCTACTGGCTCGCCATTTACGAGGGTATTTCGCTGTCGGAGCACTTTATTTTCCGCCGTGGATTCTCTGGGTACCACC
CAGAGGACTATACAGATGCAAGCAAGCTGCCGCCTGGCATCGCCTCAATCATCGCCTTTGGCTTTGGTATTATGGGCGCT
ATTCTAGGCATGTCCCAGGTGTGGTTTACCGGTCCGATCGGCAAGCTGTGCGGCGGTGATTTCGGTGGTGACGTCGGCTT
CGAGCTGGCTTTCGCGTTTGCGGCTGTGTCGTATATTGGTATGCGGGCGGTGGAAAAGAGCTACTTCAAGCGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62